Phyllanthus hypospodius

F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Phyllanthaceae/Phyllanthus

At a glance

Occurrence records150

Data sources8

Biological traits16

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Phyllanthus hypospodius's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility150 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources16 traits

Occurrence & distributionGBIF150 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 26

01Narrative

Phyllanthus hypospodius là một loài thực vật có hoa trong họ Diệp hạ châu. Loài này được F.Muell. miêu tả khoa học đầu tiên năm Mar. 1892.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraits

Size & morphology7

Fruit length5 mm

Fruit width7 mm

Leaf length87.5 mm

Leaf width32.5 mm

Plant height3 m

Seed length3.5 mm

Seed width2.5 mm

Life cycle & reproduction3

Flowering timeyyyyyynnnnnn

Life spanperennial

Sex typemonoecious

Habitat & environment6

Climatewet tropical

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub

Leaf compoundnesssimple

Woodinesswoody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phyllanthus hypospodius has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

matKEU643744.1 ↗1 430 bp

ACGT

AAAAAACAGAGGATAGAGAGTCCGTTAATAAGTTTCCCCCTTTTCCGAGGTTTCCATTCTTTTCGTATTCTATTACTTTGTTTTTATTGT …

Phyllanthus hypospodius tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Phyllanthus hypospodius carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 26 n = 13

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 132×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78

CCDB · ipcn-api-dl — Hassall, D. C. 1978. In IOPB chromosome number reports LIX. Taxon 27: 53–61.

CCDB · book-ipcn75-78 — Hassall 1978

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type150 records

Wild obs. + sensor13

Museum / vouchered133

Other4

Origin

Native8

Range

Area of Occupancy AOO188 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 5≤1 km 1≤10 km 1>10 km 1

8 georeferenced · 5 without coordinates

Open the mapobservation + sensor13

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy41% within 1 km

≤100 m 12≤1 km 21≤10 km 42>10 km 6

81 georeferenced · 52 without coordinates

Open the institutions mapphysical evidence133

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Smithfield, AU	62
Brisbane, AU	34
Canberra, AU	9
Mount Annan, AU	8
Armidale, AU	6
Museo Entomologico de Leonlocation not on record	4
Zürich, CH	3
Kew, GB	2
James Cook Townsvillelocation not on record	1
Palmerston, AU	1
Adelaide, AU	1
Austin, US	1

12 institutions · 132 of 133 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Phyllanthus hypospodius was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)