Phyllanthus gunnii

Hook.f. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Phyllanthaceae/Phyllanthus

At a glance

Occurrence records2 939

Data sources7

Biological traits41

DNA specimens4

eDNA detections2

Sources7 archives

Databases and archives Phyllanthus gunnii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 939 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources41 traits

Occurrence & distributionGBIF2 939 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Phyllanthus gunnii, the scrubby spurge, is a small plant growing in eastern and southern Australia, often on rocky forest sites near water.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology16

Fruit length2.9 mm

Fruit width3.8 mm

Leaf length20 mm

Leaf mass per area77.1 g/m2

Leaf size518 mm²

Leaf width9 mm

Leaf width max20 mm

Leaf width min10 mm

Petiole length0.185 cm

Plant height2 m

⚠ sources differ — GIFT: 2 m · AusTraits: 2.5 m · TRY: 2 m

Plant height max2.5 m

Seed length1.95 mm

Seed mass1.75 mg

Seed mass max1.75 mg

Seed mass min1.75 mg

Seed width1 mm

Life cycle & reproduction10

Deciduousnessevergreen

Dehiscencedehiscent

Dispersal typeanimal

Flowering timeyynnnnnnyyyy

Life spanperennial

Lifespan years5.5 years

Pollination syndromeinsect

Reproductive maturity1.5 years

Resprouting capacityresprouts

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub

Leaf compoundnesssimple

Leaf shapeoblong obovate orbicular widely_ovate

Woodinesswoody

Physiology & chemistry4

Leaf dry-matter content (LDMC)371 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)12.97 mm²/mg

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phyllanthus gunnii has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes5

GenBank sequences5

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN915944.1 ↗588 bpAustralia

ACGT

TTCCGTAGGTGAACCTGCGGAAGGATCTTTGTCGAAACCTGCACATGCAGTATGACCCGCGAACAAGTTTATCAACTGCGGAAGGTGCCT …

Lysiandra gunnii voucher Coveny 11474 (L) 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1★rbcLa★ITS2trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type2 939 records

Wild obs. + sensor2 176

Museum / vouchered663

Cultivated / captive1

Other99

Origin

Native146

Range

Area of Occupancy AOO8 136 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 1 794≤1 km 234≤10 km 88>10 km 11

2 127 georeferenced · 49 without coordinates

Open the mapobservation + sensor2 176

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤100 m 124≤1 km 127≤10 km 246>10 km 65

562 georeferenced · 101 without coordinates

Open the institutions mapphysical evidence663

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	146
Museo Entomologico de Leonlocation not on record	144
Brisbane, AU	138
Canberra, AU	70
Hobart, AU	53
Armidale, AU	44
Smithfield, AU	14
Batemans Bay, AU	8
NSW Dept of Planning, Industry and Environmentlocation not on record	8
QVMAGlocation not on record	5
Palmerston, AU	4
Parkville, AU	4
John T. Waterhouse Herbariumlocation not on record	4
La Trobe Universitylocation not on record	3
Wollongong, AU	3
South Kensington, GB	2
Adelaide, AU	2
Christchurch, NZ	1
Auckland, NZ	1
University of Stellenboschlocation not on record	1
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
Wellington, NZ	1
Kew, GB	1
MAlocation not on record	1
New Haven, US	1
Austin, US	1
Bronx, US	1

27 institutions · 662 of 663 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Phyllanthus gunnii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.0 °C 20.0–20.0

Seasonal swing summer↔winter10.9 °C

Max temp (day)25.5 °C

Min temp (night)15.2 °C

Precipitation65.4 mm/mo

Air humidity57.1 %

Moisture balance-49.3 mm/mo

Vapour deficit1,016 Pa

Wind speed2.30 m/s

Cloud cover26.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Phyllanthus gunnii

At a glance

Sources7 archives

Size & morphology16

Life cycle & reproduction10

Diet & foraging1

Habitat & environment10

Physiology & chemistry4

At a glance

Record type2 939 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions19 of 27 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 939 records