Phyllanthus distichus

Hook. & Arn. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Phyllanthaceae/Phyllanthus

At a glance

Occurrence records55

Data sources5

Biological traits22

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Phyllanthus distichus's data was compiled from.

GBIFGlobal Biodiversity Information Facility55 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources22 traits

Occurrence & distributionGBIF55 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 28

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology11

Fruit length max3.5 mm

Fruit length min3 mm

Fruit width max3.5 mm

Fruit width min3 mm

Leaf length max65 mm

Leaf length min15 mm

Leaf width max30 mm

Leaf width min10 mm

Plant height max1 m

Plant height min0.3 m

Seed length max1 mm

Life cycle & reproduction5

Dehiscencedehiscent

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: Tree, Subshrub, Shrub

Woodinesswoody

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phyllanthus distichus has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN915912.1 ↗638 bpUSA

ACGT

TTCCGTAGGTGAACCTGCGGAAGGATCATTTTCGAAACCTGCCCAGCAGCACGACCCGCGAACATGTTTATCAACTGCGAAAGGGGCCTT …

Cathetus distichus voucher Harold st. John 17.985 (L) 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Phyllanthus distichus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidydiploid inferred

Chromosome records26–282n range27median28mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 261×CCDB · kew

CCDB · kew — Ohri D. (pers comm. 1996)

2n 281×CCDB · book-indian_vol1

CCDB · book-indian_vol1 — Thombre, M.V. 1959a

n 141×CCDB · Cave1959

CCDB · Cave1959 — Thombre 1969a.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type55 records

Wild obs. + sensor7

Museum / vouchered48

Range

Area of Occupancy AOO160 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 7

7 georeferenced

Open the mapobservation + sensor7

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy49% within 1 km

≤1 km 17≤10 km 14>10 km 4

35 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence48

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BISHlocation not on record	28
Madison, US	8
Honolulu, US	5
Universidad de Caldas (UCaldas)location not on record	2
Riverside, US	1
Bronx, US	1
Vancouver, CA	1
Cambridge University Herbariumlocation not on record	1
Fort Worth, US	1

9 institutions · 48 of 48 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)