Phyllanthus cuscutiflorus

S.Moore · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Phyllanthaceae/Phyllanthus

At a glance

Occurrence records183

Data sources7

Biological traits21

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Phyllanthus cuscutiflorus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility183 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources21 traits

Occurrence & distributionGBIF183 records

DNA & barcodingNCBIsequences

01Narrative

Phyllanthus cuscutiflorus is a species of shrub native to Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFT

Size & morphology7

Fruit length3 mm

Fruit width4.5 mm

Leaf length82.5 mm

Leaf width37.5 mm

Plant height10 m

Seed length1.5 mm

Seed width1.5 mm

Life cycle & reproduction5

Flowering timeyyyynnnyyyyy

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment8

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

Leaf compoundnesssimple

Woodinesswoody

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phyllanthus cuscutiflorus has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN915901.1 ↗628 bpSingapore

ACGT

TTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCTCAGCAGTACAACCCGCGAACAAGTTTATCCACAGCTGAAGGTGCCTT …

Dendrophyllanthus cuscutiflorus voucher Yu 61 (L) 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type183 records

Wild obs. + sensor12

Museum / vouchered158

Cultivated / captive1

Other12

Origin

Native9

Range

Area of Occupancy AOO400 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 5≤1 km 2≤10 km 2

9 georeferenced · 3 without coordinates

Open the mapobservation + sensor12

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy46% within 1 km

≤100 m 29≤1 km 23≤10 km 47>10 km 14

113 georeferenced · 45 without coordinates

Open the institutions mapphysical evidence158

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	57
Smithfield, AU	46
Canberra, AU	20
Armidale, AU	11
Mount Annan, AU	8
James Cook Townsvillelocation not on record	5
Palmerston, AU	5
Kew, GB	3
Museo Entomologico de Leonlocation not on record	2
Austin, US	1

10 institutions · 158 of 158 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)