Phyllanthus balgooyi — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Phyllanthaceae/Phyllanthus

At a glance

Occurrence records2

Data sources5

Biological traits1

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Phyllanthus balgooyi's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF2 records

DNA & barcodingNCBIsequences

01Narrative

Phyllanthus balgooyi is an herbaceous plant in the family Phyllanthaceae, found in Palawan and Sabah. The plant is a hyperaccumulator of nickel, with a concentration of the metal exceeding 16% in the plant's phloem sap.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVP

Habitat & environment1

Climatewet tropical

05DNA & barcoding8 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phyllanthus balgooyi has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences8

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMN915857.1 ↗567 bpMalaysia

ACGT

AATGCAGTATGACCAGCGAACATGTTTACACACTGCGGAAGGTGCCCCGTGCTCCTGATGCGAGGCCCCGTTGGGTGCAATGTTCCTTGC …

Nymphanthus balgooyi voucher Van der Ent internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK4ITS4

plant barcodefungal barcode

08Occurrence & distribution

Record type2 records

Museum / vouchered2

Range

Area of Occupancy AOO8 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the institutions mapphysical evidence2