Phyllanthus arbuscula

(Sw.) J.F.Gmel. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Phyllanthaceae/Phyllanthus

At a glance

Occurrence records42

Data sources9

Biological traits9

DNA specimens0

eDNA detections0

Sources9 archives

Databases and archives Phyllanthus arbuscula's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility42 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources9 traits

Occurrence & distributionGBIF42 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 26

01Narrative

Phyllanthus arbuscula is a species of plant in the family Phyllanthaceae. It is endemic to Jamaica.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction3

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phyllanthus arbuscula has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences4

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOP740351.1 ↗629 bp

ACGT

CCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCACTGCAGTACGACCCGCGAACATGTATAACCACTGCGGAAGGTGCCATTC …

Phyllanthus arbuscula voucher I. Cordeiro 3586 (SP) small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Phyllanthus arbuscula carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 26 n = 13

Ploidydiploid inferred

Chromosome records26–262n range26median26mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 262×CCDB · ipcn-api-dl · CCDB · book-indian_vol1

CCDB · ipcn-api-dl — Kothari, N. M., C. A. Ninant & P. I. Kuriachan. 1980. In Chromosome number reports LXIX. Taxon 29: 715–716.

CCDB · book-indian_vol1 — Kothari, N.M. et al. 1980

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type42 records

Wild obs. + sensor2

Museum / vouchered40

Range

Area of Occupancy AOO100 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 2

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy63% within 1 km

≤1 km 5≤10 km 3

8 georeferenced · 32 without coordinates

Open the institutions mapphysical evidence40

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chicago, US	13
Bronx, US	7
Saint Louis, US	5
South Kensington, GB	4
Tampa, US	2
Riverside, US	1
Davis, US	1
Ann Arbor, US	1
Philadelphia, US	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Chongqing Museumlocation not on record	1
Miami, US	1
Fort Worth, US	1

13 institutions · 39 of 40 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)