Phyllanthus anamalayanus — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Phyllanthaceae/Phyllanthus

At a glance

Occurrence records223

Data sources6

Biological traits6

DNA specimens0

eDNA detections1

Sources6 archives

Databases and archives Phyllanthus anamalayanus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility223 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources6 traits

Occurrence & distributionGBIF223 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingNCBIsequences

01Narrative

Twig of Phyllanthus anamalayanus from the Anamalai Hills Phyllanthus anamalayanus is a species of plant in the family Phyllanthaceae. It is endemic to the Anamalai Hills in Coimbatore district in the state of Tamil Nadu, India. The species is a shrub or small tree occurring in the understorey of mid-elevation tropical wet evergreen forests in the Anamalai Hills, and is endemic to the Western Ghats. It is threatened by habitat loss.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction2

Life formshrub or tree

Life spanperennial

Habitat & environment4

Climatewet tropical

Climberself-supporting

Growth formtree

Woodinesswoody

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phyllanthus anamalayanus has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences3

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKC414629.1 ↗658 bp

ACGT

TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCAAAACCTTATACTGGTATGACCCGCGAACAAGTTTAGTCACTGCGGATGGTGCCCC …

Pseudoglochidion anamalayanum voucher GUH 4951 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1rbcL1ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type223 records

Wild obs. + sensor223

Range

Area of Occupancy AOO68 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 196≤1 km 22≤10 km 2>10 km 3

223 georeferenced

Open the mapobservation + sensor223

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

09Environmental DNA1 detections

Where the DNA of Phyllanthus anamalayanus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.