Phyllanthus acuminatus
Vahl · speciesAt a glance
Occurrence records1 756
Data sources14
Biological traits19
DNA specimens6
eDNA detections4
Sources14 archives
Databases and archives Phyllanthus acuminatus's data was compiled from.
WikipediaWikimedia Foundation2 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility1 756 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics6 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements3 literature sources19 traits
Chemical compositionLOTUS · NPASS65 compounds
Occurrence & distributionGBIF1 756 records
Environmental DNA1 datasets · 1 countries4 detections
DNA & barcodingBOLD · NCBI6 specimens
Genome at a glanceCCDB2n = 52
01Narrative
Phyllanthus acuminatus, the Jamaican gooseberry tree, is a herb-like plant of the family Phyllanthaceae, found in the Caribbean, Central America and South America.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTTRY
Size & morphology3
Plant height7 m
Plant height max8 m
Plant height min2 m
Life cycle & reproduction4
Deciduousnessevergreen
Life formshrub or tree
Life spanperennial
Raunkiær life formphanerophyte
Diet & foraging1
Parasiteindependent
Habitat & environment10
Aquaticterrestrial
Climateseasonally dry tropical
Climberself-supporting
Elevation max1 750 m
Elevation mean600 m
Elevation min50 m
Epiphyteterrestrial
Growth formtree
Habitat GIFTCerrado (lato sensu), Floresta Ciliar ou Galeria, Floresta Ombrófila (= Floresta Pluvial)
Woodinesswoody
Physiology & chemistry1
Wood density550 mg/cm³
03Chemical composition65 compounds
Compounds documented for Phyllanthus acuminatus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Steroidal alkaloids23
Arylnaphthalene and aryltetralin lignans6
Piperidine alkaloids $ Steroidal alkaloids3
Megastigmanes1
Corynanthe type $ Yohimbine-like alkaloids1
Documented compounds65 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (1R,3R,3'R,3'aS,4aS,6'S,6aS,6bS,7'aR,9R,11aS,11bS)-1,3,4a-trihydroxy-3',6',10,11b-tetramethylspiro[2,3,4,5,6,6a,6b,7,8,11a-decahydro-1H-benzo[a]fluorene-9,2'-3a,4,5,6,7,7a-hexahydro-3H-furo[3,2-b]pyridine]-11-one | present | NPASS | |
| (1S,2R,7R,10S,11R,14R,15R,16S,17R,20R,23S)-10,14,16,20-tetramethyl-22-azahexacyclo[12.10.0.02,11.05,10.015,23.017,22]tetracos-4-en-7-ol | present | NPASS | |
| (2S,3S,4R,5S,6S)-2-(hydroxymethyl)-6-[[(1S,2S,7S,10R,11S,14S,15R,16S,17R,20S,23S)-10,14,16,20-tetramethyl-22-azahexacyclo[12.10.0.02,11.05,10.015,23.017,22]tetracos-4-en-7-yl]oxy]oxane-3,4,5-triol | present | NPASS | |
| (3R,8R,9S,10S,14S,16S,17R)-10,17-dimethyl-17-[(1S)-1-[(2S,5S)-5-methylpiperidin-2-yl]ethyl]-2,3,4,7,8,9,11,14,15,16-decahydro-1H-cyclopenta[a]phenanthrene-3,16-diol | present | NPASS | |
| (3S,3'R,3'aR,6'S,6aS,6bS,7'aS,9S,11aS,11bR)-3',6',10,11b-tetramethyl-3-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyspiro[1,2,3,4,6,6a,6b,7,8,11a-decahydrobenzo[a]fluorene-9,2'-3a,4,5,6,7,7a-hexahydro-3H-furo[3,2-b]pyridine]-11-one | present | NPASS | |
| (3S,3'R,3'aS,6'S,6aR,7'aR,9S,10R,11aS,11bR)-3-hydroxy-3',6',10,11b-tetramethylspiro[1,2,3,4,6,6a,7,8,10,11a-decahydrobenzo[a]fluorene-9,2'-3a,4,5,6,7,7a-hexahydro-3H-furo[3,2-b]pyridine]-11-one | present | NPASS | |
| (3S,3'R,3'aS,6'S,6aS,6bR,7'aR,9R,11aS,11bS)-3-hydroxy-3',6',10,11b-tetramethylspiro[1,2,3,4,6,6a,6b,7,8,11a-decahydrobenzo[a]fluorene-9,2'-3a,4,5,6,7,7a-hexahydro-3H-furo[3,2-b]pyridine]-11-one | present | NPASS | |
| (3S,8R,9R,10R,13S,14R,17R)-10,13-dimethyl-17-[(1S)-1-[(3R)-3-methyl-2,3,4,5-tetrahydropyridin-6-yl]ethyl]-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol | present | NPASS | |
| (3S,8R,9S,10R,14S,17S)-10,17-dimethyl-17-[(1S)-1-[(2R,5S)-5-methylpiperidin-2-yl]ethyl]-2,3,4,7,8,9,11,14,15,16-decahydro-1H-cyclopenta[a]phenanthren-3-ol | present | NPASS | |
| (E)-4-[(1S,4S,6R)-2,2,6-trimethyl-4-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-7-oxabicyclo[4.1.0]heptan-1-yl]but-3-en-2-one | present | NPASS |
05DNA & barcoding6 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phyllanthus acuminatus has left across the world's sequence archives.
At a glance
DNA specimens6
Marker genes4
GenBank sequences8
eDNA detections4
Countries3
The DNA barcodea real sequence read deposited for this species
TTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCTCTGCAGTATGACCGGCGAACAAGTTTATCCACAGCGGAAGGTGCCAT …
Phyllanthus acuminatus voucher Breteler 4238 (WAG) 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK4★rbcL1★rbcLa★ITS3
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Phyllanthus acuminatus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 52 n = 26
Ploidypolyploid inferred
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 521×CCDB · book-fedorov
CCDB · book-fedorov — Webster, Ellis 1962
n 261×CCDB · Cave1962
CCDB · Cave1962 — Webster & Ellis 1962
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type1 756 records
Wild obs. + sensor240
Museum / vouchered1 513
Cultivated / captive1
Other2
Origin
Native140
Range
Area of Occupancy AOO3 276 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy86% within 1 km
≤100 m 22≤1 km 2≤10 km 2>10 km 2
28 georeferenced · 212 without coordinates
Open the mapobservation + sensor240
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy67% within 1 km
≤100 m 140≤1 km 28≤10 km 65>10 km 17
250 georeferenced · 1 263 without coordinates
Open the institutions mapphysical evidence1 513
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 1 records without
Open the mapnot free-living1
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions65 of 142 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Saint Louis, US | 267 |
| Chicago, US | 221 |
| National Biodiversity Institute, Costa Ricalocation not on record | 103 |
| Bronx, US | 73 |
| Mexico City, MX | 49 |
| Durango, MX | 42 |
| Universidad Nacional de Colombia (UNAL)location not on record | 39 |
| Museo Nacional de Costa Rica (MNCR)location not on record | 39 |
| Mérida, MX | 36 |
| Austin, US | 32 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 24 |
| Antiguo Cuscatlán, SV | 22 |
| Chaguaramas, TT | 21 |
| Madison, US | 20 |
| University of Stellenboschlocation not on record | 19 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 15 |
| San José, CR | 15 |
| Ann Arbor, US | 14 |
| Instituto do Meio Ambientelocation not on record | 14 |
| León, NI | 12 |
| Kew, GB | 12 |
| Berlin, DE | 12 |
| Universidad de La Salle (La Salle)location not on record | 11 |
| Laboratorio de Ictiologialocation not on record | 11 |
| Tapachula, MX | 10 |
| MEXUlocation not on record | 10 |
| Durham, US | 10 |
| USP-IBlocation not on record | 9 |
| Salvador, BR | 9 |
| Santa Cruz de la Sierra, BO | 9 |
| UFRPElocation not on record | 9 |
| JBRJlocation not on record | 9 |
| Universidad de Caldas (UCaldas)location not on record | 9 |
| Brasília, BR | 9 |
| UNESP-IBILCElocation not on record | 9 |
| CASlocation not on record | 8 |
| Feira de Santana, BR | 8 |
| Sucre, BO | 7 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 7 |
| San Francisco, US | 7 |
| UNICAMPlocation not on record | 7 |
| San Diego, US | 7 |
| Departamento de Sistematica e Ecologialocation not on record | 6 |
| San Francisco de Campeche, MX | 6 |
| South Kensington, GB | 5 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 5 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 5 |
| Tuxtla Gutiérrez, MX | 5 |
| Austin, US | 5 |
| HUAlocation not on record | 4 |
| UnBlocation not on record | 4 |
| Masindi, UG | 4 |
| Universidad Distrital Francisco José de Caldas (UDistrital)location not on record | 4 |
| Ivano-Frankivsk, UA | 4 |
| UFMGlocation not on record | 4 |
| San Isidro, AR | 4 |
| Davis, US | 4 |
| Tampa, US | 4 |
| UNIVASFlocation not on record | 4 |
| ASUlocation not on record | 3 |
| Fort Worth, US | 3 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 3 |
| CJBGlocation not on record | 3 |
| Cambridge, US | 3 |
| IPA/SPlocation not on record | 3 |
| Museu Paraense Emílio Goeldilocation not on record | 3 |
| Loja, EC | 3 |
| Universidad Industrial de Santander (UIS)location not on record | 3 |
| UFMSlocation not on record | 3 |
| Cenargenlocation not on record | 3 |
| Jena Microbial Resource Collectionlocation not on record | 3 |
| CEPLAClocation not on record | 3 |
| Altos de Pipe, VE | 3 |
| Edinburgh, GB | 3 |
| Universidade Federal de Goiáslocation not on record | 3 |
| UFPElocation not on record | 3 |
| Stockholm, SE | 3 |
| Tuxtla Gutiérrez, MX | 3 |
| Bogotá, D.C., CO | 2 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 2 |
| Universidade Federal de Santa Catarinalocation not on record | 2 |
| UNIVILLElocation not on record | 2 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 2 |
| UFSClocation not on record | 2 |
| Brasília, BR | 2 |
| Xiamen, CN | 2 |
| Universidad Nacional Autonoma de Mexico, Instituto de Biologialocation not on record | 2 |
| QCNElocation not on record | 2 |
| Culiacán, MX | 2 |
| Calabar, NG | 2 |
| Philadelphia, US | 2 |
| La Paz, BO | 2 |
| COLlocation not on record | 2 |
| Riverside, US | 2 |
| INBIOlocation not on record | 2 |
| Corporación Autónoma Regional Para la Defensa de la Meseta de Bucaramanga (CDMB)location not on record | 2 |
| Castelar, AR | 2 |
| Foz do Iguaçu, BR | 1 |
| UNESP-RClocation not on record | 1 |
| MAlocation not on record | 1 |
| Aarhus, DK | 1 |
| Corrientes, AR | 1 |
| Universidad Nacional Federico Villarreallocation not on record | 1 |
| Fundación Jardín Botánico Joaquín Antonio Uribe de Medellínlocation not on record | 1 |
| BMlocation not on record | 1 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 1 |
| XALlocation not on record | 1 |
| Museo de Historia Natural de El Salvadorlocation not on record | 1 |
| Universidad del Tolima (UT)location not on record | 1 |
| Ciudad Autónoma de Buenos Aires, AR | 1 |
| UNESP, Campus São José Rio Prêtolocation not on record | 1 |
| Guatemala City, GT | 1 |
| Mexico City, MX | 1 |
| Claremont, US | 1 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 1 |
| UNICAPlocation not on record | 1 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 1 |
| Elocation not on record | 1 |
| Universidad de la Amazonia (UniAmazonia)location not on record | 1 |
| Paris, FR | 1 |
| Institut de Biologia Evolutiva, (CSIC-UPF)location not on record | 1 |
| Zürich, CH | 1 |
| Wuzhou, CN | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| Montréal, CA | 1 |
| FPMZBlocation not on record | 1 |
| Campo Mourão, BR | 1 |
| Laboratory of Palaeontologylocation not on record | 1 |
| Cuiabá, BR | 1 |
| LDlocation not on record | 1 |
| Chapingo, MX | 1 |
| La Paz, MX | 1 |
| UFBAlocation not on record | 1 |
| ESALQlocation not on record | 1 |
| OTSlocation not on record | 1 |
| Universidade Federal do Espírito Santolocation not on record | 1 |
| UTFPR-CPlocation not on record | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| Universidade Federal de Sergipe (UFS)location not on record | 1 |
| Londrina, BR | 1 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 1 |
| Fundación Miguel Lillolocation not on record | 1 |
142 institutions · 1 493 of 1 513 vouchered records shown · 20 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA4 detections
Where the DNA of Phyllanthus acuminatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found4
Studies independent surveys1
Countries1
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 4 detections have coordinates
Open the map1 country0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median24.9 °C 22.8–27.0
Seasonal swing summer↔winter5.40 °C
Max temp (day)30.1 °C 27.7–32.5
Min temp (night)21.0 °C 19.0–23.0
Precipitation104 mm/mo 67.9–140
Air humidity63.1 % 63.1–63.2
Moisture balance-23.3 mm/mo -32.3–-14.3
Vapour deficit1,175 Pa 1,024–1,325
Wind speed1.60 m/s 1.50–1.70
Cloud cover30.0 % 29.9–30.0
CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.