Phyllanthus abnormis

Baill. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Phyllanthaceae/Phyllanthus

At a glance

Occurrence records342

Data sources8

Biological traits13

DNA specimens3

eDNA detections3

Sources8 archives

Databases and archives Phyllanthus abnormis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility342 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF342 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Phyllanthus abnormis, known as Drummond's leafflower, is an herbaceous plant in the family Phyllanthaceae. It grows from 10 to 50 centimeters in height. It is native to the United States (New Mexico, Texas, Oklahoma, and Florida) and Mexico (Tamaulipas). Throughout its range, it is always found growing in sand or sandy soil.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass17 mg

Seed mass max17 mg

Seed mass min17 mg

Life cycle & reproduction3

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phyllanthus abnormis has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences2

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKJ773740.1 ↗1 322 bp

ACGT

TGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTAGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAGG …

Phyllanthus abnormis ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1

plant barcode

08Occurrence & distribution

Record type342 records

Wild obs. + sensor144

Museum / vouchered198

Range

Area of Occupancy AOO992 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 94≤1 km 12≤10 km 1>10 km 17

124 georeferenced · 20 without coordinates

Open the mapobservation + sensor144

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy19% within 1 km

≤100 m 7≤1 km 8≤10 km 39>10 km 24

78 georeferenced · 120 without coordinates

Open the institutions mapphysical evidence198

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tampa, US	37
Albuquerque, US	26
Bronx, US	25
Miami, US	18
Texas Lutheran Universitylocation not on record	14
Austin, US	13
Fort Worth, US	10
Lubbock, US	8
Madison, US	7
GAlocation not on record	7
BAYLUlocation not on record	4
Texas Lutheran Universitylocation not on record	3
Philadelphia, US	3
Tall Timbers Research Stationlocation not on record	3
Chicago, US	3
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
Claremont, US	2
Dekalb, US	2
Mexico City, MX	2
Saint Louis, US	2
Millersville, US	1
Clemson, US	1
Jena Microbial Resource Collectionlocation not on record	1
Burlington, US	1
Bangkok, TH	1
Riverside, US	1

26 institutions · 198 of 198 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Phyllanthus abnormis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

Post Oak Grassland with Sandy Soil

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.6 °C 27.6–27.6

Seasonal swing summer↔winter18.0 °C

Max temp (day)32.7 °C

Min temp (night)23.0 °C

Precipitation102 mm/mo

Air humidity59.5 %

Moisture balance-81.1 mm/mo

Vapour deficit1,493 Pa

Wind speed3.10 m/s

Cloud cover29.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)