Phyllachne colensoi

(Hook.fil.) Berggr. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Stylidiaceae/Phyllachne

At a glance

Occurrence records1 302

Data sources8

Biological traits37

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Phyllachne colensoi's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 302 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources37 traits

Occurrence & distributionGBIF1 302 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Phyllachne colensoi, the yellow cushionplant, is a species of cushion plant in the Stylidiaceae family. It is native to both New Zealand and Tasmania, with colonisation of the latter being a somewhat recent dispersal. Phyllachne colensoi is frequently the dominant vegetation in upland bog habitats and is found throughout high mountain areas in New Zealand, but is only recorded from 12 sites in Tasmania in the west and south-west of the island.Wagstaff, S.J. and Wege, J. (2002). Patterns of diversification in New Zealand Stylidiaceae. American Journal of Botany, 89(5): 865-874.Good, R. (1925). On the geographical distribution of the Stylidiaceae. New Phytologist, 24(4): 225-240.Gray, A. M. (2009). 127 Stylidiaceae, version 2009:2. In M. F. Duretto (Ed.) Flora of Tasmania Online. 9 pp. (Tasmanian Herbarium, Tasmanian Museum & Art Gallery: Hobart). Phyllachne colensoi is a perennial cushion mound-forming plant with short erect stems that are densely packed. Leaves are sessile and small at only 2–3 mm long. Solitary flowers are white and held close to the cushion mound, with flowers and fruits being produced from December to March. Phyllachne colensoi was first described as Helophyllum colensoi by Joseph Dalton Hooker in 1864 and then moved to the genus Phyllachne by Sven Berggren in 1877.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYAusTraitsGIFT

Size & morphology14

Fruit length2 mm

Fruit width2 mm

Leaf length2.5 mm

Leaf length max4 mm

Leaf width2 mm

Leaf width max2 mm

Leaf width min2 mm

Plant height max0.1 m

Seed length0.9 mm

Seed length max0.9 mm

Seed length min0.9 mm

Seed mass0.109 mg

⚠ sources differ — TRY: 0.109 mg · AusTraits: 0.048 mg · GIFT: 0 mg

Seed mass max0 mg

Seed mass min0 mg

Life cycle & reproduction11

Deciduousnessevergreen

Dispersal typeunspecialized

Flowering timeyyynnnnnnnny

Life formsubshrub

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formchamaephyte

Reproduction asexualpresent

Resprouting capacityresprouts

Sex typehermaphrodite+monoecious

⚠ sources differ — AusTraits: hermaphrodite monoecious · GIFT: monoecious

Habitat & environment7

Climatesubalpine or subarctic

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Habitat GIFTAlpine

Leaf compoundnesssimple

Woodinessnon-woody

Physiology & chemistry5

Leaf dry-matter content (LDMC)375 mg/g

Leaf n8.42 mg/g

Leaf p0.647 mg/g

Nitrogen fixingnon_nitrogen_fixer

Specific leaf area (SLA)12.91 mm²/mg

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phyllachne colensoi has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences2

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSAF451609.1 ↗661 bp

ACGT

TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCGAAGCAGAACGACCAGCGAACCCGTACAAATAAAAGTCGAGGTGAAG …

Phyllachne colensoi 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type1 302 records

Wild obs. + sensor1 126

Museum / vouchered176

Origin

Native1

Range

Area of Occupancy AOO2 552 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 643≤1 km 205≤10 km 70>10 km 17

935 georeferenced · 191 without coordinates

Open the mapobservation + sensor1 126

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 2≤1 km 36≤10 km 13>10 km 6

57 georeferenced · 119 without coordinates

Open the institutions mapphysical evidence176

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Christchurch, NZ	57
Auckland, NZ	32
Hobart, AU	30
Wellington, NZ	20
Museo Entomologico de Leonlocation not on record	9
Canberra, AU	5
Rotorua, NZ	5
Kew, GB	4
Claremont, US	3
Kensington, AU	2
Flagstaff, US	2
Adelaide, AU	2
Mount Annan, AU	1
Chicago, US	1
QVMAGlocation not on record	1
Armidale, AU	1

16 institutions · 175 of 176 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Phyllachne colensoi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Phyllachne colensoi

At a glance

Sources8 archives

Size & morphology14

Life cycle & reproduction11

Habitat & environment7

Physiology & chemistry5

At a glance

Record type1 302 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 16 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 302 records