Phylica pubescens

Aiton · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rhamnaceae/Phylica

At a glance

Occurrence records675

Data sources5

Biological traits21

DNA specimens4

eDNA detections3

Sources5 archives

Databases and archives Phylica pubescens's data was compiled from.

GBIFGlobal Biodiversity Information Facility675 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources21 traits

Occurrence & distributionGBIF675 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI4 specimens

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Plant height1.5 m

Plant height max1.5 m

Plant height min0.25 m

Seed mass21.04 mg

Seed mass max22 mg

Seed mass min19.23 mg

Life cycle & reproduction3

Deciduousnessevergreen

Life formshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max800 m

Elevation min45 m

Epiphyteterrestrial

Growth formshrub

Mycorrhiza typearbuscular

Woodinesswoody

Physiology & chemistry2

Leaf n10.14 mg/g

Photosynthetic pathwayC3

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phylica pubescens has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences5

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAF328814.1 ↗689 bp

ACGT

AATCGTACCAGGTTCGTAGGTGAACTGCGGAAGGATCATTGTCGAAACTGCACAGCAGAACGACCGCGAACCTGTGAAAACATGCTGGGA …

Phylica pubescens 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL4★rbcLa★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type675 records

Wild obs. + sensor651

Museum / vouchered23

Cultivated / captive1

Range

Area of Occupancy AOO432 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 498≤1 km 64≤10 km 15>10 km 1

578 georeferenced · 73 without coordinates

Open the mapobservation + sensor651

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced · 21 without coordinates

Open the institutions mapphysical evidence23

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cape Town, ZA	6
Universität Göttingenlocation not on record	3
Pretoria, ZA	2
Rotorua, NZ	2
University of Johannesburglocation not on record	1
Tampa, US	1
Saint Louis, US	1
Christchurch, NZ	1
LDlocation not on record	1

9 institutions · 18 of 23 vouchered records shown · 5 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Phylica pubescens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.1 °C 10.1–10.1

Seasonal swing summer↔winter12.3 °C

Max temp (day)15.5 °C

Min temp (night)4.20 °C

Precipitation137 mm/mo

Air humidity56.2 %

Moisture balance30.4 mm/mo

Vapour deficit544 Pa

Wind speed8.50 m/s

Cloud cover12.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)