Phragmites australis
(Cav.) Trin. ex Steud. · speciesAt a glance
Occurrence records993 661
Data sources16
Biological traits155
DNA specimens159
eDNA detections98
Sources16 archives
Databases and archives Phragmites australis's data was compiled from.
WikipediaWikimedia Foundation19 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility992 926 records↗
OBISOcean Biodiversity Information System735 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI98 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics159 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements6 literature sources155 traits
Chemical compositionLOTUS · NPASS55 compounds
Occurrence & distributionGBIF · OBIS993 661 records
Environmental DNA1 datasets · 16 countries98 detections
DNA & barcodingBOLD · NCBI159 specimens
Genome at a glanceCCDB · GoaT · NCBI1.1 Gbp
01Narrative
Phragmites australis, known as the common reed, is a broadly distributed wetland grass growing nearly 20 ft tall.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDAUSDATRYWCVP
Size & morphology24
Fruit length1.4 mm
Inflorescence length max40 cm
Inflorescence length min10 cm
Leaf length550 mm
Leaf length max600 mm
Leaf length min350 mm
Leaf mass1 009 mg
⚠ sources differ — AusTraits: 1 009 mg · LEDA: 410 mg
Leaf mass per area204 g/m2
Leaf size4 807 mm²
⚠ sources differ — TRY: 4 807 mm² · AusTraits: 4 443 mm² · LEDA: 6 926 mm² · GIFT: 6 926 mm²
Leaf width32 mm
⚠ sources differ — AusTraits: 32 mm · GIFT: 30 mm
Leaf width max35 mm
Leaf width min30 mm
Plant height3.08 m
⚠ sources differ — GIFT: 3.08 m · AusTraits: 3 m · LEDA: 2.5 m · USDA: 3.96 m · TRY: 1.79 m
Plant height generative2.5 m
Plant height max9 m
Plant height min0.8 m
Seed length1.5 mm
⚠ sources differ — TRY: 1.5 mm · AusTraits: 7.2 mm
Seed mass0.123 mg
⚠ sources differ — TRY: 0.123 mg · AusTraits: 0.101 mg · LEDA: 0.14 mg · GIFT: 0.427 mg
Seed mass max4.01 mg
Seed mass min0 mg
Seed volume0.18 mm³
Seed volume max0.18 mm³
Seed volume min0.18 mm³
Seed width4 mm
Life cycle & reproduction40
After harvest regrowth rateModerate
Bloom periodSummer
Coppice potentialNo
Deciduousnessdeciduous
⚠ sources differ — TRY: deciduous · GIFT: evergreen
Dispersal typewind
⚠ sources differ — AusTraits: anemochory · LEDA: epizoochor · GIFT: anemochorous
Flower colourwhite
Flower conspicuousNo
Flower length max12 mm
Flower length min7 mm
Flowering endOct
Flowering startJul
Flowering timennnnnnnnyyyn
Fruit seed period beginSummer
Fruit seed period endFall
Growth rate USDARapid
Life formhelophyte or rhizomatous hydrogeophyte
Life spanperennial
Lifespan categoryLong
Lifespan years100 years
Pollination modeabiotic
Pollination syndromeself+wind
⚠ sources differ — AusTraits: self wind · GIFT: wind
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedNo
Propagated by sodNo
Propagated by sprigsYes
Propagated by tubersNo
Raunkiær life formcryptophyte
Reproduction asexualabsent
Resprout abilityNo
Resprouting capacitypartial_resprouting
Seed number1 680
Seed spread rateSlow
Seedling vigorHigh
Self fertilizationabsent
Sex typehermaphrodite
Vegetative spread rateRapid
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment34
Active growth periodSpring
Adapted to coarse textured soilsYes
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation max3 800 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerDense
Foliage porosity winterModerate
Foliage textureCoarse
Fruit colourwhite
Fruit fleshinessdry
Fruit typecaryopsis
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid · TRY: H
Growth form USDARhizomatous
Habitat GIFTÁrea Antrópica, Restinga
Hedge toleranceLow
Known allelopathNo
Leaf compoundnesssimple
Leaf formlinear
Leaf retentionNo
Leaf shapenarrowly_lanceolate
Low growing grassNo
Mycorrhizaabsent
Mycorrhiza typeAMNM
Root depth min20 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry29
Anaerobic toleranceHigh
C:N ratioHigh
Caco3 toleranceMedium
Cold stratification requiredNo
Drought toleranceLow
Fertility requirementMedium
Fire resistantNo
Fire toleranceHigh
Frost free days min110 days
Leaf C:N ratio17.36 g/g
Leaf c452 mg/g
Leaf dry-matter content (LDMC)400 mg/g
⚠ sources differ — TRY: 400 mg/g · LEDA: 429 mg/g
Leaf n26.87 mg/g
Leaf p1.39 mg/g
Moisture useMedium
Nitrogen fixation levelLow
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Precipitation max60 in
Precipitation min12 in
Protein potentialLow
Salinity toleranceHigh
Seed longevity index0
Shade toleranceHigh
Soil pH max8.7 pH
Soil pH min4.5 pH
Specific leaf area (SLA)15.65 mm²/mg
Temperature min-38 °F
Wood density246 mg/cm³
Uses & economy14
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalLow
Palatable graze animalLow
Palatable humanNo
Post productNo
Pulpwood productNo
ToxicityNone
Veneer productNo
Other traits12
Diaspore typegenerative dispersule
Fall conspicuousNo
Fruit seed abundanceMedium
Fruit seed conspicuousYes
Fruit seed persistenceYes
Inflorescencepanicle
Leaf marginentire
Leaf spinesno
Leaf thornsno
Planting density max4 800 per acre
Planting density min3 450 per acre
Shoot orientationerect
03Chemical composition55 compounds
Compounds documented for Phragmites australis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Flavones11
Anthocyanidins7
Spirostane steroids5
Pregnane steroids5
Cinnamic acids and derivatives3
Documented compounds55 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Dioscin | present | NPASS | |
| (1S)-1,5-Anhydro-1-[2-(3,4-dihydroxyphenyl)-5-hydroxy-7-methoxy-4-oxo-4H-1-benzopyran-8-yl]-D-glucitol | present | LOTUS | |
| (25S)-3beta-spirostan-5-ene-3-ol-3-O-alpha-L-rhamnopyranosyl-(1->2)-[alpha-L-rhamnopyranosyl-(1->4)]-beta-D-glucopyranoside | present | NPASS | |
| (4aR)-3,4,4a,5,18,19-Hexahydro-9,21,22,26-tetramethoxy-4-methyl-2H-1,24:12,15-dietheno-6,10-metheno-16H-pyrido[2',3':17,18][1,10]dioxacycloeicosino[2,3,4-ij]isoquinoline | present | NPASS | |
| 1-[(3R,8R,9S,10R,13R,14R,16S,17S)-3-[(2S,3S,4R,5R,6S)-4-hydroxy-6-(hydroxymethyl)-3,5-bis[[(2R,3S,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxy]oxan-2-yl]oxy-16-methoxy-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-17-yl]ethanone | present | NPASS | |
| 1-[(3S,8R,9S,10R,13S,14S)-3-[(2R,3R,4S,5R,6R)-5-hydroxy-6-(hydroxymethyl)-4-[(2S,3S,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxy-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15-decahydro-1H-cyclopenta[a]phenanthren-17-yl]ethanone | present | NPASS | |
| 1-[(3S,8R,9S,10R,13S,14S)-3-[(2R,3R,4S,5S,6R)-4-hydroxy-6-(hydroxymethyl)-3,5-bis[[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxy]oxan-2-yl]oxy-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15-decahydro-1H-cyclopenta[a]phenanthren-17-yl]-2-methoxyethanone | present | NPASS | |
| 1-[(3S,8S,9S,10R,13S,14S,16R,17R)-3-[(2R,3R,4S,5S,6R)-4-hydroxy-6-(hydroxymethyl)-3,5-bis[[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxy]oxan-2-yl]oxy-16-methoxy-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-17-yl]ethanone | present | NPASS | |
| 3-(5-Hexene-1,3-diyn-1-yl)-6-(1-propyn-1-yl)-1,2-dithiin | present | NPASS | |
| 3-[[(2R,3S,4R,5R,6S)-6-[2-(3,4-dihydroxyphenyl)-5,7-dihydroxychromenylium-3-yl]oxy-3,4,5-trihydroxyoxan-2-yl]methoxy]-3-oxopropanoic acid | present | LOTUS |
05DNA & barcoding159 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phragmites australis has left across the world's sequence archives.
At a glance
DNA specimens159
Marker genes13
GenBank sequences10
eDNA detections98
Countries16
The DNA barcodea real sequence read deposited for this species
CGCCAAAAGACGCTCCCCCCAGCCCCGGGCGGAGGGACGCGGCGTCTGGCCCCCCGCGCCGCAGGGCGCGGTGGGCCGAAGTTGGGGCTG …
Phragmites australis voucher WW-8045 internal transcribed spacer region, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK2★rbcL2★rbcLa★trnL★ITS6★ITS1★ITS2atpF-atpHpsbK-psbIrpoBrpoC1trnH-psbA
animal barcodeplant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Phragmites australis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 056 240 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Phragmites australis1.06 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 48 n = 24
Ploidy2× / 4× / 8× cytotypes
Chromosome records28–1202n range48median48mode93records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 4840×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl +8
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J. et al., 1976: Index of chromosome numbers of Slovakian flora (Part 5). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 25: 1-18.
CCDB · iapt — IAPT/IOPB Chromosome Data 6
CCDB · iapt
CCDB · poland — Skali?ska M., Pogan E., Jankun A. et al. 1968. Further studies in chromosome numbers of Polish Angiosperms. Seventh contribution. Acta Biol. Cracov. Ser. Bot. 11, 199-224.
CCDB · ipcn-api-dl — Parfenov, V. I. & S. A. Dmitrieva. 1987. Kariologicheskaja kharakteristika predstavitelej flory sosudistykh rastenij Berezinskogo Biosfernogo Zapovednika. II. Zapov. Belorussii Issl. 11: 62–69.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Love, A. & D. Love. 1981a. In Chromosome number reports LXXI. Taxon 30: 509–511.
CCDB · ipcn-api-dl — Probatova. 2006. Further chromosome studies on vascular plant species from Sakhalin, Moneron and Kurile Islands. Biodivers. Biogeogr. Kuril Islands Sakhalin 2: 93–110.
CCDB · book-ipcn67-71 — CURRAN, P.L. 1969. Fertility of Phragmites communis Trin. Irish Naturalists' J. 16: 242.
CCDB · book-ipcn75-78 — Vachova 1976
CCDB · book-ipcn75-78 — Sokolovskaya & Probatova 1976a
CCDB · book-indian_vol2 — Hunter, A.W.S. 1934 ; Tischler, G. 1934, 1937 ; Rohweder, H. 1937 ; Hagerup, O. 1941b; Saura, F. 1948; L6ve, A. I954b ; Skalinska, M. et al. 1968 ; Curran, P.L. 1969 '
CCDB · book-fedorov — Hunter 1934
CCDB · book-fedorov — Tischler 1934, 1937
CCDB · book-fedorov — Rohweder 1937
CCDB · book-fedorov — Hagerup 1941b
CCDB · book-fedorov — Saura 1948a
CCDB · book-fedorov — LOve A. 1954b
CCDB · CromoCat 2015 — Clevering, O. A. & Lissner, J. (1999). Taxonomy, chromosome numbers, clonal diversity and population dynamics of Phragmites australis Aquatic Botany 64: 185-208
CCDB · CromoCat 2015 — Connor, H. E., Dawson, M. I., Keating, R.D. & Gill, L.S. (1998). Chromosome numbers of Phragmites australis (Arundineae: Gramineae) in New Zealand New Zealand Journal of Botany 36: 465-469
CCDB · CromoCat 2015 — Djebrouni, M. (1992). Variabilite|3 morphologique, caryologique et enzymatique chez quelques populations de Phragmites australis (Cav.) Trin. ex Steud. Folia Geobotanica et Phytotaxonomica 27: 49-59
CCDB · CromoCat 2015 — Gorenflot, R. & Panahi, M. (1979). Le complexe polyploide du Phragmites australis (Cav.) Trin. ex Steud. (= P. communis Trin.) en Iran. Revue de Cytologie et de Biologie Végétales, le Botaniste 2: 67-81.
CCDB · CromoCat 2015 — Gorenflot, R. (1986). Degrés et niveaux de la variation du nombre chromosomique chez Phragmites australis (Cav.) Trin. ex Steud. Veröf. Geobot. Inst. E.T.H. Stiftung Rübel Zürich 87:53-67
CCDB · CromoCat 2015 — Gorenflot, R., Hubac, J. M., Jay, M. & collaborators. (1984). Le complexe polyploïde du Phragmites australis (Cav.) Trin. ex Steud. dans la région méditerranéenne. Webbia 38: 715-721
CCDB · CromoCat 2015 — Lövkvist, B. & Hultgård, U.-M. (1999). Chromosome numbers in south Swedish vascular plants Opera botanica 137: 1-42
CCDB · CromoCat 2015 — Parfenov, V. I. & S. A. Dmitrieva. (1987). Kariologicheskaja kharakteristika predstavitelej flory sosudistykh rastenij Berezinskogo Biosfernogo Zapovednika. II Zapovedniki Belorussii Issledovaniia 11: 62-69.
CCDB · CromoCat 2015 — Pauca-Comanescu, M., O. A. Clevering, J. Hanganu & M. Gridin (1999). Phenotypic differences among ploidy levels of Phragmites australis growing in Romania Aquatic Botany 64: 223-234
CCDB · CromoCat 2015 — Zong, W., R. Chen, K. Taniguchi & K. Kondo (1991). A chromosome study in intraspecific polyploidy of Phragmites australis and its related species Kromosomo 63-64: 2168-2172
CCDB · CromoCat 2015 — Arohonka, T. (1982). Kromosomilukumäärityksiä Nauvon Seilin saaren putkilokasveista. (Chromosome counts of vascular plants of the island Seiliin Nauvo, SW Finland) Turun Yliopiston Biologian Laitoksen Julkaisuja 3: 1-12.
CCDB · CromoCat 2015 — Dmitrieva, S. A. (1985b). Chromosome numbers in the representatives of the families Lamiaceae and Poaceae of the Byelorussian flora. Bot. Žurn. 70: 128-130.
CCDB · CromoCat 2015 — Hindakova, M. (1976). Index of chromosome numbers of Slovakian flora. (Part 5). Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 25: 1-18.
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1981b). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXI]. Taxon 30(2): 509-511.
2n 9612×GoaT · Kew Plant DNA C-values Database · CCDB · book-ipcn75-78 · CCDB · CromoCat 2015
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · book-ipcn75-78 — Gorenflot et al. 1972
CCDB · CromoCat 2015 — Clevering, O. A. & Lissner, J. (1999). Taxonomy, chromosome numbers, clonal diversity and population dynamics of Phragmites australis Aquatic Botany 64: 185-208
CCDB · CromoCat 2015 — Connor, H. E., Dawson, M. I., Keating, R.D. & Gill, L.S. (1998). Chromosome numbers of Phragmites australis (Arundineae: Gramineae) in New Zealand New Zealand Journal of Botany 36: 465-469
CCDB · CromoCat 2015 — Djebrouni, M. (1992). Variabilite|3 morphologique, caryologique et enzymatique chez quelques populations de Phragmites australis (Cav.) Trin. ex Steud. Folia Geobotanica et Phytotaxonomica 27: 49-59
CCDB · CromoCat 2015 — González Aguilera, J. J., Ludeña Reyes, P. & Fernández-Peralta, A. M. (1990). Intra- and interspecific variations in nuclear parameters of two closely related species of Narcissus L. Genetica 82: 25-31
CCDB · CromoCat 2015 — Gorenflot, R. & Panahi, M. (1979). Le complexe polyploide du Phragmites australis (Cav.) Trin. ex Steud. (= P. communis Trin.) en Iran. Revue de Cytologie et de Biologie Végétales, le Botaniste 2: 67-81.
CCDB · CromoCat 2015 — Gorenflot, R. (1986). Degrés et niveaux de la variation du nombre chromosomique chez Phragmites australis (Cav.) Trin. ex Steud. Veröf. Geobot. Inst. E.T.H. Stiftung Rübel Zürich 87:53-67
CCDB · CromoCat 2015 — Gorenflot, R., Hubac, J. M., Jay, M. & collaborators. (1984). Le complexe polyploïde du Phragmites australis (Cav.) Trin. ex Steud. dans la région méditerranéenne. Webbia 38: 715-721
CCDB · CromoCat 2015 — Ishii, Y. & Kadono, Y. (2000). Classification of two Phragmites species, P. australis and P. japonica, in Lake Biwa - the Yodo River system, Japan Acta Phytotaxonomica et Geobotanica 51: 177-186
CCDB · CromoCat 2015 — Pauca-Comanescu, M., O. A. Clevering, J. Hanganu & M. Gridin (1999). Phenotypic differences among ploidy levels of Phragmites australis growing in Romania Aquatic Botany 64: 223-234
CCDB · CromoCat 2015 — Zong, W., R. Chen, K. Taniguchi & K. Kondo (1991). A chromosome study in intraspecific polyploidy of Phragmites australis and its related species Kromosomo 63-64: 2168-2172
2n 3610×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 +6
CCDB · iber-fl — Cytotaxonomy of spanish plants. II. Monocotyledons. Lve, A. & E. Kjellqvist.Lagascalia3(2): 147-182(1973).
CCDB · ipcn-api-dl — GERVAIS, C. 1981. Liste annotee de nombres chromosomiques de la flore vasculaire du nord-est de l'Amerique. II. Naturaliste Canad. 108: 143–152.
CCDB · book-ipcn75-78 — Labadie 1976a
CCDB · book-ipcn73-74 — LOEVE, A., & E. KJELLQVIST. 1973. Cytotaxonomy of Spanish plants. Monocotyledons. Lagascalia 3: 14 7-182. I
CCDB · book-indian_vol2 — Tischler, G. 1942
CCDB · danthoinoides — (Moore, 1967)
CCDB · book-fedorov — Tischler 1942
CCDB · Oberlander2016 — Moore, 1967
CCDB · CromoCat 2015 — Gervais, C. (1981). Liste annotée de nombres chromosomiques de la flore vasculaire du Nord-Est de l`Amérique. II. Naturaliste Canad. 108: 143-152.
CCDB · CromoCat 2015 — Valdés, B., S. Talavera & E. Fernández Galiano. (eds.) (1987). Flora Vascular de Andalucía Occidental. Barcelona
2n 7210×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Pohl, R. W. & G. Davidse. 1971. Chromosome numbers of Costa Rican grasses. Brittonia 23(3): 293–324.
CCDB · book-ipcn67-71 — POHL, R.W., & G. DAVIDSE. 1971. Chromosome numbers of Costa Rican grasses. Brittonia 23: 293-324.
CCDB · CromoCat 2015 — Clevering, O. A. & Lissner, J. (1999). Taxonomy, chromosome numbers, clonal diversity and population dynamics of Phragmites australis Aquatic Botany 64: 185-208
CCDB · CromoCat 2015 — González Aguilera, J. J., Ludeña Reyes, P. & Fernández-Peralta, A. M. (1990). Intra- and interspecific variations in nuclear parameters of two closely related species of Narcissus L. Genetica 82: 25-31
CCDB · CromoCat 2015 — Gorenflot, R. & Panahi, M. (1979). Le complexe polyploide du Phragmites australis (Cav.) Trin. ex Steud. (= P. communis Trin.) en Iran. Revue de Cytologie et de Biologie Végétales, le Botaniste 2: 67-81.
CCDB · CromoCat 2015 — Gorenflot, R. (1986). Degrés et niveaux de la variation du nombre chromosomique chez Phragmites australis (Cav.) Trin. ex Steud. Veröf. Geobot. Inst. E.T.H. Stiftung Rübel Zürich 87:53-67
CCDB · CromoCat 2015 — Gorenflot, R., Hubac, J. M., Jay, M. & collaborators. (1984). Le complexe polyploïde du Phragmites australis (Cav.) Trin. ex Steud. dans la région méditerranéenne. Webbia 38: 715-721
CCDB · CromoCat 2015 — Pauca-Comanescu, M., O. A. Clevering, J. Hanganu & M. Gridin (1999). Phenotypic differences among ploidy levels of Phragmites australis growing in Romania Aquatic Botany 64: 223-234
CCDB · CromoCat 2015 — Zong, W., R. Chen, K. Taniguchi & K. Kondo (1991). A chromosome study in intraspecific polyploidy of Phragmites australis and its related species Kromosomo 63-64: 2168-2172
CCDB · CromoCat 2015 — Pohl, R. W. & G. Davidse. (1971). Chromosome numbers of Costa Rican grasses. Brittonia 23: 293-324.
2n 544×CCDB · iber-fl · CCDB · CromoCat 2015
CCDB · iber-fl — Nmeros cromossmicos para a flora portuguesa, 38-63. Queirs, M.Bol. Soc. Brot. ser. 254: 47-64(1980).
CCDB · CromoCat 2015 — Connor, H. E., Dawson, M. I., Keating, R.D. & Gill, L.S. (1998). Chromosome numbers of Phragmites australis (Arundineae: Gramineae) in New Zealand New Zealand Journal of Botany 36: 465-469
CCDB · CromoCat 2015 — Gorenflot, R., Cartier, D. & Lenoir, A. (1975). La polypoidie du P. australis (Cav.) Trin. ex Steud. dans le Bassin Méditerranéen. In La Flore du Bassin Méditerranéen. Colloques Internatl. C.N.R.S. C.N.R.S., Paris. 235: 165-173.
CCDB · CromoCat 2015 — Queirós, M. (1980a). Números cromossómicos para a flora portuguesa, 38-63. Bol. Soc. Brot. 54: 47-64.
2n 564×CCDB · iapt · CCDB · CromoCat 2015
CCDB · iapt — IAPT/IOPB Chromosome Data 13
CCDB · CromoCat 2015 — Gorenflot, R. (1986). Degrés et niveaux de la variation du nombre chromosomique chez Phragmites australis (Cav.) Trin. ex Steud. Veröf. Geobot. Inst. E.T.H. Stiftung Rübel Zürich 87:53-67
CCDB · CromoCat 2015 — Chepinoga, V. V., Gnutikov, A. A., Lubogoschinsky, P. I. & Fleckenstein, K. M. (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:889-891
CCDB · CromoCat 2015 — Probatova, N. S., Seledets, V. P., Gnutikov, A. A. & Shatokhina, A. V. (2008). IAPT/IOPB Chromosome Data 6 Taxon 57(4): 1267-1273
2n 402×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Ko|3zuharov, S. I. & A. V. Petrova. 1991. Chromosome numbers of Bulgarian angiosperms. Fitologija 39: 72–77.
CCDB · CromoCat 2015 — Kozuharov, S. & Petrova, A. (1991). Chromosome numbers of Bulgarian Angiosperms. Fitologija 39: 72-77.
2n 502×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Gorenflot, R. (1986). Degrés et niveaux de la variation du nombre chromosomique chez Phragmites australis (Cav.) Trin. ex Steud. Veröf. Geobot. Inst. E.T.H. Stiftung Rübel Zürich 87:53-67
CCDB · CromoCat 2015 — Gorenflot, R., Cartier, D. & Lenoir, A. (1975). La polypoidie du P. australis (Cav.) Trin. ex Steud. dans le Bassin Méditerranéen. In La Flore du Bassin Méditerranéen. Colloques Internatl. C.N.R.S. C.N.R.S., Paris. 235: 165-173.
2n 522×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Gorenflot, R. (1986). Degrés et niveaux de la variation du nombre chromosomique chez Phragmites australis (Cav.) Trin. ex Steud. Veröf. Geobot. Inst. E.T.H. Stiftung Rübel Zürich 87:53-67
CCDB · CromoCat 2015 — Gorenflot, R., Cartier, D. & Lenoir, A. (1975). La polypoidie du P. australis (Cav.) Trin. ex Steud. dans le Bassin Méditerranéen. In La Flore du Bassin Méditerranéen. Colloques Internatl. C.N.R.S. C.N.R.S., Paris. 235: 165-173.
2n 842×CCDB · book-indian_vol2 · CCDB · book-fedorov
CCDB · book-indian_vol2 — Tarnavschi, I.T. 1948
CCDB · book-fedorov — Tamavschi 1948
2n 281×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Seledets. 2005. Ecological area of species: karyological aspects. Pages 95--97 in Karyology, Karyosystematics and Molecular Phylogeny. St. Petersburg, Russia.
2n 421×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Gorenflot, R., Cartier, D. & Lenoir, A. (1975). La polypoidie du P. australis (Cav.) Trin. ex Steud. dans le Bassin Méditerranéen. In La Flore du Bassin Méditerranéen. Colloques Internatl. C.N.R.S. C.N.R.S., Paris. 235: 165-173.
2n 441×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Gorenflot, R., Cartier, D. & Lenoir, A. (1975). La polypoidie du P. australis (Cav.) Trin. ex Steud. dans le Bassin Méditerranéen. In La Flore du Bassin Méditerranéen. Colloques Internatl. C.N.R.S. C.N.R.S., Paris. 235: 165-173.
2n 461×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Gorenflot, R., Cartier, D. & Lenoir, A. (1975). La polypoidie du P. australis (Cav.) Trin. ex Steud. dans le Bassin Méditerranéen. In La Flore du Bassin Méditerranéen. Colloques Internatl. C.N.R.S. C.N.R.S., Paris. 235: 165-173.
2n 491×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Gorenflot, R., Cartier, D. & Lenoir, A. (1975). La polypoidie du P. australis (Cav.) Trin. ex Steud. dans le Bassin Méditerranéen. In La Flore du Bassin Méditerranéen. Colloques Internatl. C.N.R.S. C.N.R.S., Paris. 235: 165-173.
2n 511×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Gorenflot, R., Cartier, D. & Lenoir, A. (1975). La polypoidie du P. australis (Cav.) Trin. ex Steud. dans le Bassin Méditerranéen. In La Flore du Bassin Méditerranéen. Colloques Internatl. C.N.R.S. C.N.R.S., Paris. 235: 165-173.
2n 531×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Connor, H. E., Dawson, M. I., Keating, R.D. & Gill, L.S. (1998). Chromosome numbers of Phragmites australis (Arundineae: Gramineae) in New Zealand New Zealand Journal of Botany 36: 465-469
2n 1201×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Ishii, Y. & Kadono, Y. (2000). Classification of two Phragmites species, P. australis and P. japonica, in Lake Biwa - the Yodo River system, Japan Acta Phytotaxonomica et Geobotanica 51: 177-186
n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Chepinoga, V. V., Gnutikov, A. A., Lubogoschinsky, P. I. & Fleckenstein, K. M. (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:889-891
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=0.930 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness98.9% BUSCO
08Occurrence & distribution
Record type993 661 records
Wild obs. + sensor967 877
Museum / vouchered22 149
Cultivated / captive41
Fossil16
Other3 578
Origin
Native33 061
Introduced203
Range
Area of Occupancy AOO698 628 km²
Depth
0–200 m sunlit469
200–1000 m twilight0
1–4 km midnight0
>4 km abyssal0
median 0 m · max 2.8 m · 469 records with depth
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy53% within 1 km
≤100 m 254 555≤1 km 148 207≤10 km 352 455>10 km 4 993
760 210 georeferenced · 207 667 without coordinates
Open the mapobservation + sensor967 877
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy37% within 1 km
≤100 m 1 352≤1 km 4 041≤10 km 8 301>10 km 825
14 519 georeferenced · 7 630 without coordinates
Open the institutions mapphysical evidence22 149
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy10% within 1 km
≤100 m 2≤1 km 1≤10 km 8>10 km 19
30 georeferenced · 11 without coordinates
Open the mapnot free-living41
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions241 of 490 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 8 774 |
| Moscow State Universitylocation not on record | 464 |
| Helsinki, FI | 437 |
| Olocation not on record | 357 |
| LDlocation not on record | 335 |
| Beijing, CN | 291 |
| Québec, CA | 289 |
| Adelaide, AU | 226 |
| Pretoria, ZA | 220 |
| Salzburg, AT | 213 |
| Saint Louis, US | 181 |
| Museo Entomologico de Leonlocation not on record | 179 |
| Trondheim, NO | 173 |
| Mount Annan, AU | 166 |
| Odawara, JP | 163 |
| Brisbane, AU | 150 |
| MeiseBGlocation not on record | 141 |
| Bronx, US | 137 |
| National Marine Biodiversity Institute of Korealocation not on record | 136 |
| Karlsruhe, DE | 135 |
| Mexico City, MX | 130 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 127 |
| Görlitz, DE | 125 |
| Canberra, AU | 118 |
| Uniwersytet Warszawskilocation not on record | 114 |
| Chongqing Museumlocation not on record | 113 |
| Université Lavallocation not on record | 110 |
| Université Lavallocation not on record | 105 |
| Oulu, FI | 95 |
| Fukushima Universitylocation not on record | 95 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 91 |
| Oskarshamn, SE | 90 |
| St. Paul, US | 90 |
| Claremont, US | 87 |
| SLU Artdatabankenlocation not on record | 86 |
| Turku, FI | 84 |
| International Salmonella Centre (W.H.O.)location not on record | 80 |
| Bergen, NO | 79 |
| University of Stellenboschlocation not on record | 77 |
| Chiba, JP | 76 |
| Durango, MX | 76 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 72 |
| Kew, GB | 71 |
| BFLlocation not on record | 70 |
| Irkutsk State Universitylocation not on record | 69 |
| DAOlocation not on record | 68 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 67 |
| BRNUlocation not on record | 66 |
| Montréal, CA | 65 |
| Nagano City, JP | 63 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 59 |
| Jyväskylä, FI | 57 |
| TROMlocation not on record | 57 |
| Riverside, US | 55 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 55 |
| Kunming, CN | 51 |
| Mus. Tinro, Vladyvostoklocation not on record | 50 |
| Phoenix, US | 49 |
| Provincia di Livornolocation not on record | 48 |
| GMBAlocation not on record | 47 |
| Davis, US | 46 |
| Bern, CH | 45 |
| Shinshu Universitylocation not on record | 45 |
| Tokushima, JP | 45 |
| Hobart, AU | 45 |
| WTUlocation not on record | 43 |
| BIO-UNIPIlocation not on record | 43 |
| Kuopio, FI | 42 |
| Cape Town, ZA | 42 |
| Tomioka, JP | 40 |
| Berlin, DE | 40 |
| Toronto, CA | 40 |
| Pullman, US | 40 |
| University of New Hampshirelocation not on record | 39 |
| Spearfish, US | 39 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 37 |
| Toyama, JP | 37 |
| Green Bay, US | 37 |
| San Isidro, AR | 36 |
| South Kensington, GB | 36 |
| KMNlocation not on record | 35 |
| US | 34 |
| Flagstaff, US | 34 |
| MAlocation not on record | 31 |
| Christchurch, NZ | 30 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 30 |
| Acadia Universitylocation not on record | 30 |
| College Park, US | 30 |
| BDBClocation not on record | 29 |
| ASUlocation not on record | 29 |
| Barcelona, ES | 29 |
| Córdoba, ES | 29 |
| Xining, CN | 28 |
| Tsukuba, JP | 28 |
| Auckland, NZ | 27 |
| Palmerston, AU | 27 |
| IHCantabrialocation not on record | 26 |
| Armidale, AU | 26 |
| Logan, US | 26 |
| WINlocation not on record | 26 |
| Jena Microbial Resource Collectionlocation not on record | 26 |
| National Biodiversity Institute, Costa Ricalocation not on record | 25 |
| Fort Worth, US | 25 |
| UGentlocation not on record | 25 |
| Albuquerque, US | 25 |
| Mérida, MX | 25 |
| TRTlocation not on record | 24 |
| Akita Prefectural Museumlocation not on record | 24 |
| Allentown, US | 24 |
| Denver, US | 24 |
| Lausanne, CH | 23 |
| TAIElocation not on record | 23 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 23 |
| València, ES | 23 |
| Kawasaki Shi Tama Ku, JP | 22 |
| Wlocation not on record | 21 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 21 |
| Austin, US | 21 |
| Durban, ZA | 21 |
| BClocation not on record | 21 |
| Corvallis, US | 20 |
| Canadian Department of Agriculturelocation not on record | 20 |
| Tampa, US | 20 |
| Rishon Le Zion, IL | 19 |
| IFAN Ch. A. Dioplocation not on record | 19 |
| TUR-Alocation not on record | 19 |
| Saint John, CA | 19 |
| SASKlocation not on record | 18 |
| Lincoln, US | 18 |
| KR | 18 |
| Tallinn, EE | 18 |
| Santa Barbara, US | 18 |
| Smithfield, AU | 17 |
| Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record | 17 |
| CANlocation not on record | 17 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 16 |
| Jiangxi College of Educationlocation not on record | 16 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 16 |
| Dover, US | 16 |
| Missoula, US | 16 |
| Xiamen, CN | 15 |
| Victoria, CA | 15 |
| Bangkok, TH | 15 |
| Entomological Society of Latvialocation not on record | 15 |
| Otaru, JP | 15 |
| JP | 15 |
| Whitewater, US | 15 |
| Bando, JP | 15 |
| University of Alberta Museumslocation not on record | 14 |
| GJOlocation not on record | 14 |
| Guilin, CN | 13 |
| Chadron, US | 13 |
| IFR-DNFlocation not on record | 13 |
| San Diego, US | 13 |
| US | 13 |
| Dresden, DE | 13 |
| SXTCMlocation not on record | 13 |
| CICYTEXlocation not on record | 13 |
| Vitoria, ES | 12 |
| Millersville, US | 12 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 12 |
| CJBGlocation not on record | 12 |
| Edinburgh, GB | 12 |
| Porvoo, FI | 12 |
| Kushiro City Museumlocation not on record | 12 |
| McWane Science Centerlocation not on record | 12 |
| Stockholm, SE | 12 |
| CASlocation not on record | 12 |
| KIRMlocation not on record | 12 |
| Sendai, JP | 12 |
| Hiratsuka City Museumlocation not on record | 12 |
| College of the Atlantic, Museumlocation not on record | 12 |
| Kensington, AU | 11 |
| Natural History Museum Rotterdamlocation not on record | 11 |
| New Brunswick, US | 11 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 11 |
| Ann Arbor, US | 11 |
| Nishihara, JP | 11 |
| Chengdu, CN | 11 |
| Knoxville, US | 10 |
| DULlocation not on record | 10 |
| Frankfurt am Main | 10 |
| Cape Town, ZA | 10 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 10 |
| Miami, US | 10 |
| Norfolk, US | 10 |
| Inner Mongolia Universitylocation not on record | 10 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 10 |
| PRClocation not on record | 10 |
| Bozeman, US | 10 |
| Tula State Universitylocation not on record | 10 |
| Philadelphia, US | 10 |
| DOI/NPS, Greenbelt Parklocation not on record | 10 |
| Kochi, JP | 9 |
| Córdoba, AR | 9 |
| Williamsburg, US | 9 |
| Plocation not on record | 9 |
| John T. Waterhouse Herbariumlocation not on record | 9 |
| nlocation not on record | 9 |
| Tuscaloosa, US | 9 |
| Royal British Columbia Museumlocation not on record | 9 |
| BSBIlocation not on record | 9 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 9 |
| GZUlocation not on record | 9 |
| Moscow, US | 9 |
| Montréal, CA | 9 |
| Uniwersytet Jagiellońskilocation not on record | 9 |
| Hokkaido University Museumlocation not on record | 9 |
| Kandalaksha State Nature Reservelocation not on record | 8 |
| Hudson, US | 8 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 8 |
| Hermosillo, MX | 8 |
| San Francisco de Campeche, MX | 8 |
| Madrid, ES | 8 |
| Wuzhou, CN | 8 |
| Urumqi, CN | 8 |
| Tapachula, MX | 8 |
| Chicago, US | 8 |
| Porrentruy, CH | 8 |
| Parkville, AU | 8 |
| DOI/NPS, Acadia National Parklocation not on record | 8 |
| EL PASO, US | 8 |
| Instituto de Investigação Científica Tropicallocation not on record | 8 |
| Bloomington, US | 7 |
| Iwate Prefectural Museumlocation not on record | 7 |
| San Luis Obispo, US | 7 |
| Pittsburg, US | 7 |
| National Institute of Biological Resourceslocation not on record | 7 |
| Columbia, US | 7 |
| New Haven, US | 7 |
| Sagamihara, JP | 7 |
| La Paz, MX | 7 |
| University of Western Ontariolocation not on record | 7 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 7 |
| Henderson, US | 7 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 7 |
| Lubbock, US | 7 |
| Pamplona, ES | 7 |
| Tartu, EE | 7 |
| Ishikawa Museum of Natural Historylocation not on record | 7 |
| Osaka, JP | 7 |
| Ischia Marine Centrelocation not on record | 6 |
| Chapel Hill, US | 6 |
| Pocatello, US | 6 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 6 |
| Angwin, US | 6 |
| Salamanca, ES | 6 |
| Alicante, ES | 6 |
| Elocation not on record | 6 |
| University of Waterloolocation not on record | 6 |
| Los Angeles, US | 6 |
| Mlocation not on record | 6 |
| Museum of the Rockieslocation not on record | 6 |
| Antiguo Cuscatlán, SV | 6 |
| Grand Junction, US | 6 |
| Mount Pleasant, US | 6 |
| Wollongong, AU | 5 |
| Kyoto Universitylocation not on record | 5 |
| Morgantown, US | 5 |
| Bandelier National Monumentlocation not on record | 5 |
| SZUlocation not on record | 5 |
| Arcata, US | 5 |
| Area de Conservacion Guanacastelocation not on record | 5 |
| Paris, FR | 5 |
| Lanzhou Institute of Desert Research, Academia Sinicalocation not on record | 5 |
| Ensenada, MX | 5 |
| Madison, US | 5 |
| BAYLUlocation not on record | 5 |
| University of Southern Mississippilocation not on record | 5 |
| J.F.Oberlin Universitylocation not on record | 5 |
| KOMlocation not on record | 5 |
| Pamplona, ES | 5 |
| Nishihara, JP | 5 |
| Chicago, US | 5 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 4 |
| Metsähallituslocation not on record | 4 |
| Banyoles, ES | 4 |
| LfUlocation not on record | 4 |
| Sevilla, ES | 4 |
| Obihiro Centennial City Museumlocation not on record | 4 |
| Phyletisches Museum Jenalocation not on record | 4 |
| Ciudad de México, MX | 4 |
| Manitoba Museumlocation not on record | 4 |
| St. Augustine, TT | 4 |
| Northridge, US | 4 |
| JMSlocation not on record | 4 |
| University of New Brunswicklocation not on record | 4 |
| GHPG$location not on record | 4 |
| Bourges, FR | 4 |
| Orem, US | 4 |
| LNBG$location not on record | 4 |
| León, NI | 4 |
| Tromso University Museumlocation not on record | 4 |
| State Herbarium of South Australialocation not on record | 4 |
| University of Guelph, OAC Herbariumlocation not on record | 4 |
| NSMKlocation not on record | 4 |
| BRLUlocation not on record | 4 |
| Jackson, US | 4 |
| Beijing, CN | 4 |
| San Angelo, US | 4 |
| Boise, US | 4 |
| University of Toronto Mississaugalocation not on record | 4 |
| Batemans Bay, AU | 4 |
| Aarhus, DK | 4 |
| University of Copenhagen, Natural History Museum of Denmark, Herbarium Clocation not on record | 4 |
| ISAlocation not on record | 4 |
| Durango, US | 4 |
| La Trobe Universitylocation not on record | 3 |
| Parthenon Tama History Museumlocation not on record | 3 |
| Provo, US | 3 |
| Castelar, AR | 3 |
| Glocation not on record | 3 |
| Nanjing, CN | 3 |
| Adam Mickiewicz University in Poznańlocation not on record | 3 |
| Museo Achille Folettolocation not on record | 3 |
| 3 | |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 3 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 3 |
| GAlocation not on record | 3 |
| QVMAGlocation not on record | 3 |
| Sharjah Research Academy, Seed Bank and Herbariumlocation not on record | 3 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 3 |
| Granada, ES | 3 |
| Northeastern Forestry Universitylocation not on record | 3 |
| Hazara Universitylocation not on record | 3 |
| Oswego, US | 3 |
| The Nova Scotia Museum of Natural History, Collectionslocation not on record | 3 |
| James Cook Townsvillelocation not on record | 3 |
| Severin-McDaniel Insect Collectionlocation not on record | 3 |
| nbflocation not on record | 3 |
| Zürich, CH | 3 |
| Chapingo, MX | 3 |
| Valdosta State Universitylocation not on record | 3 |
| Glarus, CH | 3 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 3 |
| Durham, US | 3 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 3 |
| Badajoz, ES | 3 |
| Ciudad de México, MX | 3 |
| Arizona Western Collegelocation not on record | 3 |
| BGBMlocation not on record | 3 |
| Uniwersytet Opolskilocation not on record | 3 |
| Burlington, US | 3 |
| Chengdu, CN | 3 |
| Uppsala, SE | 3 |
| Torreón, MX | 2 |
| Forest Herbarium Ibadan (FHI)location not on record | 2 |
| RJBJCIlocation not on record | 2 |
| Uniwersytet Śląski w Katowicachlocation not on record | 2 |
| Emporia, US | 2 |
| Rovaniemi, FI | 2 |
| Caldwell, US | 2 |
| Arizona State University Biocollectionslocation not on record | 2 |
| Sapporo, JP | 2 |
| Taipei, TW | 2 |
| Toyota city nature sanctuarylocation not on record | 2 |
| Brookings, US | 2 |
| Taiyuan Normal Universitylocation not on record | 2 |
| Dekalb, US | 2 |
| Guasave, MX | 2 |
| Mohonk Preservelocation not on record | 2 |
| Sharjah Seed Bank & Herbariumlocation not on record | 2 |
| Ivano-Frankove, UA | 2 |
| Wellington, NZ | 2 |
| Frauenfeld, CH | 2 |
| Forssa, FI | 2 |
| Yaoundé, CM | 2 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 2 |
| DASSHlocation not on record | 2 |
| Weber State Universitylocation not on record | 2 |
| MCNAMlocation not on record | 2 |
| Honolulu, US | 2 |
| Vancouver, CA | 2 |
| 黔东南州民族医药研究所标本室location not on record | 2 |
| Samara National Research Universitylocation not on record | 2 |
| Irvine, US | 2 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 2 |
| Tall Timbers Research Stationlocation not on record | 2 |
| Herbario Universidad de Concepciónlocation not on record | 2 |
| Nagatoro-machi, Chichibu-gun, JP | 2 |
| ENTClocation not on record | 2 |
| Trois-Rivières, CA | 2 |
| Awka, NG | 2 |
| San José, CR | 2 |
| California Academy of Scienceslocation not on record | 2 |
| Ciudad Autónoma de Buenos Aires, AR | 2 |
| Canadian Museum of Nature, National Herbarium of Canadalocation not on record | 2 |
| Naturalis Biodiversity Centerlocation not on record | 2 |
| National Museum Waleslocation not on record | 2 |
| Tilburg, NL | 2 |
| State University of New York, College at Oneontalocation not on record | 2 |
| The University of Arizonalocation not on record | 2 |
| Wuhan, CN | 2 |
| Jinghong, CN | 2 |
| Rotorua, NZ | 2 |
| Kiritappu Wetland National Trustlocation not on record | 1 |
| Cambridge, US | 1 |
| Montecillo, Texcoco, MX | 1 |
| Servico de Microbiologia e Imunologialocation not on record | 1 |
| Kyiv, UA | 1 |
| Universidad de El Salvadorlocation not on record | 1 |
| FLADlocation not on record | 1 |
| HNBlocation not on record | 1 |
| Taipei, TW | 1 |
| Jiujiang Forestry Institutelocation not on record | 1 |
| Tuxtla Gutiérrez, MX | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Institute of the biological problems of the North FEB RASlocation not on record | 1 |
| Korea National Arboretumlocation not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Yangling, CN | 1 |
| San Jose, US | 1 |
| Lanzhou, CN | 1 |
| Göteborg, SE | 1 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 1 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 1 |
| Universidad Nacional de La Pampalocation not on record | 1 |
| Llocation not on record | 1 |
| Meguro Parasitological Museumlocation not on record | 1 |
| VENlocation not on record | 1 |
| South African National Biodiversity Institutelocation not on record | 1 |
| Sion, CH | 1 |
| Columbus State University Herbariumlocation not on record | 1 |
| ZRC-SAZUlocation not on record | 1 |
| John May Museum of Natural Historylocation not on record | 1 |
| Madrid, ES | 1 |
| Bend, US | 1 |
| Seoul, KR | 1 |
| sxphclocation not on record | 1 |
| BMlocation not on record | 1 |
| HCIBlocation not on record | 1 |
| Zhejiang Museum of Natural Historylocation not on record | 1 |
| Brasília, BR | 1 |
| BG-NMNHSlocation not on record | 1 |
| Tacoma, US | 1 |
| INFlocation not on record | 1 |
| Universität Tübingenlocation not on record | 1 |
| Yunnan Universitylocation not on record | 1 |
| NMBU:MINAlocation not on record | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| Minia, EG | 1 |
| Lord Fairfax Community Collegelocation not on record | 1 |
| Gujarat Biodiversity Gene Banklocation not on record | 1 |
| Hunan Geological Museumlocation not on record | 1 |
| Bureau of Land Management, Medford District Officelocation not on record | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| Cenargenlocation not on record | 1 |
| Namur, BE | 1 |
| Coimbra, PT | 1 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 1 |
| Fairfax, US | 1 |
| Comisión Técnico Consultiva de Coeficientes de Agostaderolocation not on record | 1 |
| Department of Land Resources Managementlocation not on record | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| Zürich, CH | 1 |
| BISHlocation not on record | 1 |
| WAGlocation not on record | 1 |
| EEZA-CSIClocation not on record | 1 |
| DBF-NHMDlocation not on record | 1 |
| Zapopan, MX | 1 |
| Juriquilla, MX | 1 |
| BioFokuslocation not on record | 1 |
| Universität Göttingenlocation not on record | 1 |
| Philadelphia, US | 1 |
| Fulda, DE | 1 |
| ESP003location not on record | 1 |
| China Agricultural Universitylocation not on record | 1 |
| H-Schuhwlocation not on record | 1 |
| Calabar, NG | 1 |
| Muzaffarabad, PK | 1 |
| Instituto de Pesquisas Ambientaislocation not on record | 1 |
| Portland, US | 1 |
| National Botanic Garden of Waleslocation not on record | 1 |
| University of Albertalocation not on record | 1 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 1 |
| IWEP FEB RASlocation not on record | 1 |
| Universidad Nacional Autonoma de Mexico, Instituto de Biologialocation not on record | 1 |
| Universidad Nacional de Colombia (UNAL)location not on record | 1 |
| MEXUlocation not on record | 1 |
| North Carolina Museum of Natural Scienceslocation not on record | 1 |
| Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record | 1 |
| ULBF-AGRlocation not on record | 1 |
| AUAlocation not on record | 1 |
| UoB-IBlocation not on record | 1 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 1 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 1 |
| Brock University (BU)location not on record | 1 |
| XALlocation not on record | 1 |
| Santiago de Compostela, ES | 1 |
| Kingston, US | 1 |
490 institutions · 20 217 of 22 149 vouchered records shown · 1 618 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA98 detections
Where the DNA of Phragmites australis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found98
Studies independent surveys1
Countries16
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 98 detections have coordinates
Open the map16 countries0
Tamarisk, catclaw, squaw waterweedWillow & arrowweed riparian bordered by dese…Wetland/Coastal Sage Scrub with Baccharis pi…meadow
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median16.9 °C 10.2–27.4
Seasonal swing summer↔winter15.1 °C
Max temp (day)20.4 °C 12.9–31.1
Min temp (night)12.7 °C 6.70–24.7
Precipitation72.7 mm/mo 2.20–103
Air humidity59.3 % 46.9–64.7
Moisture balance-26.6 mm/mo
Vapour deficit766 Pa 503–1,558
Wind speed3.50 m/s
Cloud cover38.4 % 14.4–51.7
CHELSA 1981–2010, ~9 km grid, at location & month of 52 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.