Phragmipedium sargentianum

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Phragmipedium

At a glance

Occurrence records17

Data sources5

Biological traits8

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Phragmipedium sargentianum's data was compiled from.

GBIFGlobal Biodiversity Information Facility17 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources8 traits

Occurrence & distributionGBIF17 records

DNA & barcodingNCBIsequences

02Traits & measurements

SourcesGIFT

Life cycle & reproduction1

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTFloresta Ciliar ou Galeria, Vegetação Sobre Afloramentos Rochosos

Woodinessnon-woody

05DNA & barcoding5 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phragmipedium sargentianum has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY643427.1 ↗705 bp

ACGT

AAGGATCATTGTTGAGACCGCAAAATATACGATCGAGTTAATCCGGAGGACTGGTGTAGTTTGGTCTCCCAGGGGCGTTGGCTACTGCGG …

Phragmipedium sargentianum voucher Pg10-1 (Shepherd College, Shepherdstown, WV, USA) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1rbcL1ITS3

plant barcodefungal barcode

08Occurrence & distribution

Record type17 records

Wild obs. + sensor4

Museum / vouchered13

Origin

Native11

Range

Area of Occupancy AOO56 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 4

4 georeferenced

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 13 records without

Open the institutions mapphysical evidence13

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Departamento de Sistematica e Ecologialocation not on record	4
UFPElocation not on record	3
Chaguaramas, TT	2
Bronx, US	1
CEPLAClocation not on record	1
JBRJlocation not on record	1
UNIVASFlocation not on record	1

7 institutions · 13 of 13 vouchered records shown