Photostomias goodyeari

Kenaley & Hartel, 2005 · species

image placeholder — illustration coming later

Animalia/Chordata/Stomiiformes/Stomiidae/Photostomias

At a glance

Occurrence records211

Data sources8

Biological traits6

DNA specimens5

eDNA detections3

Sources8 archives

Databases and archives Photostomias goodyeari's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility185 records↗

OBISOcean Biodiversity Information System26 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS211 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD5 specimens

01Narrative

Photostomias goodyeari is een straalvinnige vissensoort uit de familie van Stomiidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 2005 door Kenaley & Hartel.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length17.5 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebathypelagic

Other traits3

Depth max2 000 m

Depth min85 m

Vulnerability11.35

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Photostomias goodyeari has left across the world's sequence archives.

At a glance

DNA specimens5

BINs3

Marker genes1

eDNA detections3

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 85% of positions are identical in every specimen.

Where individuals differ — all 98 variable positions, in barcode order

2Cvariable

13Avariable

31Amostly conserved

49Amostly conserved

55Tmostly conserved

64Gmostly conserved

67Gmostly conserved

76Tmostly conserved

100Cmostly conserved

103Cmostly conserved

109Tmostly conserved

115Tmostly conserved

139Cmostly conserved

142Gmostly conserved

160Avariable

172Gmostly conserved

178Gvariable

193Gmostly conserved

196Tmostly conserved

202Tmostly conserved

211Tmostly conserved

217Gmostly conserved

220Tmostly conserved

223Tmostly conserved

226Gmostly conserved

235Amostly conserved

247Tmostly conserved

253Cmostly conserved

262Cmostly conserved

265Gmostly conserved

271Gmostly conserved

274Tmostly conserved

277Cvariable

284Cmostly conserved

295Tmostly conserved

301Cmostly conserved

304Cmostly conserved

310Tmostly conserved

316Cmostly conserved

319Gmostly conserved

328Amostly conserved

331Amostly conserved

334Cmostly conserved

337Cmostly conserved

340Gmostly conserved

343Amostly conserved

370Gmostly conserved

373Amostly conserved

385Gvariable

397Cmostly conserved

398Cvariable

400Gmostly conserved

406Amostly conserved

409Tmostly conserved

412Tmostly conserved

413Gmostly conserved

415Gmostly conserved

425Cmostly conserved

427Gmostly conserved

430Tmostly conserved

445Tmostly conserved

448Cmostly conserved

451Amostly conserved

466Amostly conserved

478Tmostly conserved

481Amostly conserved

484Gmostly conserved

493Tmostly conserved

497Cmostly conserved

499Gmostly conserved

505Gmostly conserved

511Cmostly conserved

514Cmostly conserved

515Tmostly conserved

517Amostly conserved

529Cmostly conserved

535Gmostly conserved

539Cmostly conserved

541Amostly conserved

544Cmostly conserved

553Tmostly conserved

556Tmostly conserved

562Amostly conserved

568Tmostly conserved

571Amostly conserved

578Cmostly conserved

592Cmostly conserved

593Tmostly conserved

598Tmostly conserved

610Tmostly conserved

616Cmostly conserved

625Gmostly conserved

628Amostly conserved

631Tmostly conserved

634Avariable

640Cmostly conserved

646Gmostly conserved

652Cvariable

ACTGTACCTAGTATTTGGTGCATGAGCTGGAATAGTTGGAACTGCACTAAGTCTTCTTATTCGGGCGGAGCTGGGTCAGCCGGGCGCTCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)6.4%

Haplotypes3

BINs3

Most divergent pair14.0%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Photostomias guerneisame genus13.8%Cetoscarus bicolorsame order16.8%Cetoscarus ocellatussame order16.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type211 records

Wild obs. + sensor19

Museum / vouchered192

Range

Area of Occupancy AOO716 km²

Depth

0–200 m sunlit0

200–1000 m twilight22

1–4 km midnight0

>4 km abyssal0

median 500.5 m · max 824 m · 22 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 3

3 georeferenced · 16 without coordinates

Open the mapobservation + sensor19

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 101

101 georeferenced · 91 without coordinates

Open the institutions mapphysical evidence192

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	163
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	4
Wuzhou, CN	4
Washington, US	3
University of California San Diegolocation not on record	2
South Kensington, GB	1
Copenhagen, DK	1

7 institutions · 178 of 192 vouchered records shown · 5 without an institution code

09Environmental DNA3 detections

Where the DNA of Photostomias goodyeari was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.7 °C 20.8–24.5

Seasonal swing summer↔winter9.20 °C

Max temp (day)24.7 °C 21.7–25.4

Min temp (night)22.9 °C 20.1–23.8

Precipitation77.8 mm/mo 73.2–112

Air humidity62.2 % 59.8–63.8

Vapour deficit1,047 Pa 977–1,152

Cloud cover38.8 % 35.0–41.4

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)