Photinia prionophylla — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rosaceae/Photinia

At a glance

Occurrence records68

Data sources8

Biological traits28

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Photinia prionophylla's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility68 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources28 traits

Occurrence & distributionGBIF68 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Photinia prionophylla is a species in the family Rosaceae of flowering plants.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology16

Fruit length7 mm

Fruit length max8 mm

Fruit length min6 mm

Fruit width7 mm

Fruit width max8 mm

Fruit width min6 mm

Inflorescence length max9 cm

Inflorescence length min7.0 cm

Leaf length57.5 mm

Leaf length max70 mm

Leaf length min45 mm

Leaf width max50 mm

Leaf width min40 mm

Plant height1.5 m

Plant height max2 m

Plant height min1 m

Life cycle & reproduction4

Flower length max9 mm

Flower length min7 mm

Life formshrub or tree

Life spanperennial

Habitat & environment7

Climatetemperate

Climberself-supporting

Elevation max3 300 m

Elevation mean2 900 m

Elevation min2 500 m

Growth formtree

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Photinia prionophylla has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences6

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSGQ368480.1 ↗589 bp

ACGT

TCGAACCTGCGCAGCAGAACGACCCGAGAACCGGTTTCAACGTCGGGGGCCGGCGGGCCTTCGGGCCCGGCGACCCCCTATCCCGGGAGC …

Photinia prionophylla internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

rbcL3ITS3

plant barcodefungal barcode

08Occurrence & distribution

Record type68 records

Museum / vouchered68

Range

Area of Occupancy AOO100 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 68 records without

Open the institutions mapphysical evidence68

10Collections & institutions

Holding institutions9 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kunming, CN	27
Beijing, CN	19
Cambridge, US	11
Chengdu, CN	4
Hangzhou, CN	2
Southwest Forestry Collegelocation not on record	1
Nanchong, CN	1
Guangzhou, CN	1
Wuhan, CN	1
Cambridge, US	1

10 institutions · 68 of 68 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Photinia prionophylla was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.