Phostria metalobalis

Hampson, 1912 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Phostria

At a glance

Occurrence records88

Data sources6

Biological traits0

DNA specimens92

eDNA detections93

Sources6 archives

Databases and archives Phostria metalobalis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility88 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI93 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics92 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF88 records

Environmental DNA1 datasets · 2 countries93 detections

DNA & barcodingBOLD92 specimens

01Narrative

Phostria metalobalis is a moth in the family Crambidae. It was described by George Hampson in 1912. It is found in Guyana and Costa Rica.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding92 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phostria metalobalis has left across the world's sequence archives.

At a glance

DNA specimens92

BINs1

Marker genes1

eDNA detections93

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus92 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

81Gmostly conserved

212Cmostly conserved

433Gvariable

550Gmostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGTAGTCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.23%

Haplotypes9

BIN1

Most divergent pair0.76%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Glyphodes cosmarchasame family6.8%Phostria truncatalissame genus7.3%Pycnarmon cribratasame family7.6%Glyphodes stolalissame family7.6%Patania deficienssame family8.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type88 records

Wild obs. + sensor19

Museum / vouchered69

Range

Area of Occupancy AOO140 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 3≤1 km 10≤10 km 1

14 georeferenced · 5 without coordinates

Open the mapobservation + sensor19

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 69 records without

Open the institutions mapphysical evidence69

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	51
University of Pennsylvanialocation not on record	2
Smithsonian Tropical Research Institutelocation not on record	1
The University of the West Indies, Trinidad and Tobagolocation not on record	1

4 institutions · 55 of 69 vouchered records shown · 14 without an institution code

09Environmental DNA93 detections

Where the DNA of Phostria metalobalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found93

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 93 detections have coordinates

Open the map2 countries0

Forest1. Forest & Woodland | 1.6. Subtropical/Trop…1. Forest & Woodland|1.6. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.4 °C 23.4–25.6

Seasonal swing summer↔winter2.30 °C

Max temp (day)26.9 °C 25.6–28.8

Min temp (night)22.1 °C 21.1–23.8

Precipitation288 mm/mo 65.5–427

Air humidity72.7 % 65.5–75.5

Moisture balance179 mm/mo -98.3–299

Vapour deficit817 Pa 717–1,128

Wind speed1.50 m/s 1.10–3.60

Cloud cover34.2 % 16.1–45.8

CHELSA 1981–2010, ~9 km grid, at location & month of 80 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)