Phostria euagra

species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Phostria

At a glance

Occurrence records296

Data sources6

Biological traits0

DNA specimens36

eDNA detections38

Sources6 archives

Databases and archives Phostria euagra's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility296 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI38 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics36 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF296 records

Environmental DNA1 datasets · 3 countries38 detections

DNA & barcodingBOLD36 specimens

01Narrative

Phostria euagra is a moth in the family Crambidae. It was described by Cajetan Felder, Rudolf Felder and Alois Friedrich Rogenhofer in 1875. It is found in Amazonas, Brazil.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding36 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phostria euagra has left across the world's sequence archives.

At a glance

DNA specimens36

BINs2

Marker genes1

eDNA detections38

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus36 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Diversity (π)0.76%

Haplotypes2

BINs2

Most divergent pair4.9%

Where individuals differ — all 32 variable positions, in barcode order

16Cmostly conserved

56Tmostly conserved

74Tmostly conserved

82Cmostly conserved

100Tmostly conserved

118Cmostly conserved

154Cmostly conserved

169Gmostly conserved

200Gmostly conserved

217Amostly conserved

304Tmostly conserved

340Cmostly conserved

343Tmostly conserved

349Amostly conserved

358Tmostly conserved

367Tmostly conserved

391Cmostly conserved

397Cmostly conserved

400Tmostly conserved

412Gmostly conserved

466Gmostly conserved

500Cmostly conserved

533Cmostly conserved

553Amostly conserved

562Amostly conserved

565Gmostly conserved

574Tmostly conserved

581Cmostly conserved

601Cmostly conserved

613Cmostly conserved

628Gmostly conserved

634Cmostly conserved

AACTTTATATTTTATCTTTGGAATTTGAGCAGGAATAGTAGGAACATCTTTAAGTTTATTAATTCGAGCTGAATTAGGAACCCCAGGAAT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Udea numeralissame family8.5%Udea ferrugalissame family8.8%Patania deficienssame family9.1%Metasia ateloxanthasame family9.1%Bradina diagonalissame family9.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type296 records

Wild obs. + sensor115

Museum / vouchered181

Range

Area of Occupancy AOO480 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 49≤1 km 24≤10 km 7>10 km 4

84 georeferenced · 31 without coordinates

Open the mapobservation + sensor115

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 181 records without

Open the institutions mapphysical evidence181

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	166

1 institutions · 166 of 181 vouchered records shown · 15 without an institution code

09Environmental DNA38 detections

Where the DNA of Phostria euagra was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found38

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 38 detections have coordinates

Open the map3 countries0

1. Forest & Woodland|1.6. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.0 °C 23.1–25.2

Seasonal swing summer↔winter2.30 °C

Max temp (day)26.9 °C 25.5–28.4

Min temp (night)21.3 °C 20.5–22.2

Precipitation288 mm/mo 78.0–423

Air humidity73.2 % 65.3–75.5

Moisture balance179 mm/mo -63.9–295

Vapour deficit756 Pa 704–1,027

Wind speed1.50 m/s 1.10–2.60

Cloud cover31.3 % 15.2–45.7

CHELSA 1981–2010, ~9 km grid, at location & month of 38 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)