Phostria cyrisalis

species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Phostria

At a glance

Occurrence records751

Data sources4

Biological traits0

DNA specimens87

eDNA detections86

Sources4 archives

Databases and archives Phostria cyrisalis's data was compiled from.

GBIFGlobal Biodiversity Information Facility751 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI86 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics87 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF751 records

Environmental DNA1 datasets · 1 countries86 detections

DNA & barcodingBOLD87 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding87 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phostria cyrisalis has left across the world's sequence archives.

At a glance

DNA specimens87

BINs1

Marker genes1

eDNA detections86

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus86 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

217Gvariable

223Tmostly conserved

523Cmostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTTTAAGATTACTAATTCGAGCTGAATTAGGAAATCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.25%

Haplotypes27

BIN1

Most divergent pair1.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Micromartinia mnemusalissame family4.6%Cnaphalocrocis trapezalissame family6.2%Rehimena auritinctasame family6.2%Patania deficienssame family6.7%Cnaphalocrocis bilinealissame family6.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type751 records

Museum / vouchered751

Range

Area of Occupancy AOO224 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 751 records without

Open the institutions mapphysical evidence751

10Collections & institutions

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	733
University of Pennsylvanialocation not on record	2

2 institutions · 735 of 751 vouchered records shown · 16 without an institution code

09Environmental DNA86 detections

Where the DNA of Phostria cyrisalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found86

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 86 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.0 °C 23.1–25.7

Seasonal swing summer↔winter2.30 °C

Max temp (day)26.9 °C 25.5–27.7

Min temp (night)21.8 °C 20.7–24.2

Precipitation288 mm/mo 83.3–478

Air humidity70.8 % 66.6–75.5

Moisture balance179 mm/mo -44.1–344

Vapour deficit895 Pa 717–1,040

Wind speed2.00 m/s 1.10–3.10

Cloud cover31.4 % 15.1–42.3

CHELSA 1981–2010, ~9 km grid, at location & month of 86 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)