Phosphila turbulenta

Hübner, 1818 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Phosphila

At a glance

Occurrence records3 041

Data sources7

Biological traits0

DNA specimens15

eDNA detections15

Sources7 archives

Databases and archives Phosphila turbulenta's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 041 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 041 records

Environmental DNA1 datasets · 2 countries15 detections

DNA & barcodingBOLD15 specimens

01Narrative

Phosphila turbulenta, the turbulent phosphila, is a species of cutworm or dart moth in the family Noctuidae. It is found in North America. The MONA or Hodges number for Phosphila turbulenta is 9618.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phosphila turbulenta has left across the world's sequence archives.

At a glance

DNA specimens15

BINs1

Marker genes1

eDNA detections15

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus15 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

1Amostly conserved

31Gmostly conserved

47Tmostly conserved

316Amostly conserved

367Tmostly conserved

368Gmostly conserved

370Amostly conserved

382Amostly conserved

506Gmostly conserved

532Cmostly conserved

541Tmostly conserved

574Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCGGGTATAGTAGGAACTTCCTTAAGATTATTAATTCGTGCTGAATTAGGTAACCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.40%

Haplotypes8

BIN1

Most divergent pair0.61%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Lythrodes tripunctasame family6.5%Bryophila seladonasame family6.6%Nyctobrya simonyisame family6.7%Eriopyga macrolepiasame family7.0%Hexorthodes jocosasame family7.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 041 records

Wild obs. + sensor2 913

Museum / vouchered128

Range

Area of Occupancy AOO8 148 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 1 579≤1 km 381≤10 km 196>10 km 272

2 428 georeferenced · 485 without coordinates

Open the mapobservation + sensor2 913

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy12% within 1 km

≤1 km 10≤10 km 60>10 km 12

82 georeferenced · 46 without coordinates

Open the institutions mapphysical evidence128

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	38
East Lansing, US	27
Mississippi State, US	21
Cambridge, US	8
Cleveland Museum of Natural History, OH (CLEV)location not on record	6
CUlocation not on record	5
UDlocation not on record	4
Natural History Museum of Utahlocation not on record	3
OSUClocation not on record	3
St. Paul, US	3
North Carolina State University Insect Museumlocation not on record	3
Decorah, US	1

12 institutions · 122 of 128 vouchered records shown · 6 without an institution code

09Environmental DNA15 detections

Where the DNA of Phosphila turbulenta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map2 countries0

Mixed habitatGrassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.9 °C 16.9–25.7

Seasonal swing summer↔winter19.2 °C

Max temp (day)24.2 °C 22.8–27.4

Min temp (night)13.5 °C 11.7–22.7

Precipitation77.2 mm/mo 76.3–175

Air humidity55.5 % 54.8–62.8

Moisture balance-75.6 mm/mo -92.9–11.7

Vapour deficit988 Pa 852–1,235

Wind speed5.80 m/s 2.70–6.10

Cloud cover43.1 % 30.8–43.2

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Phosphila turbulenta

At a glance

Sources7 archives

At a glance

Record type3 041 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 12 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 041 records