Phosphaenus hemipterus

(Geoffroy, 1762) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Lampyridae/Phosphaenus

At a glance

Occurrence records1 931

Data sources6

Biological traits0

DNA specimens14

eDNA detections5

Sources6 archives

Databases and archives Phosphaenus hemipterus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 931 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 931 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD14 specimens

01Narrative

De kortschildglimworm is een keversoort uit de familie glimwormen (Lampyridae). De wetenschappelijke naam van de soort werd voor het eerst geldig gepubliceerd in 1762 door Geoffroy.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phosphaenus hemipterus has left across the world's sequence archives.

At a glance

DNA specimens14

BINs2

Marker genes3

eDNA detections5

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Diversity (π)2.4%

Haplotypes2

BINs2

Most divergent pair0.15%

Where individuals differ — all 35 variable positions, in barcode order

25Amostly conserved

49Tmostly conserved

67Cvariable

85Cvariable

88Avariable

106Cmostly conserved

199Avariable

200Gvariable

212Tmostly conserved

217Tvariable

247Tvariable

271Cvariable

277Avariable

280Avariable

304Avariable

337Gvariable

343Tvariable

349Cmostly conserved

373Avariable

415Gvariable

421Cvariable

455Gvariable

472Cvariable

473Amostly conserved

490Cvariable

508Gvariable

517Tvariable

518Gvariable

533Tvariable

539Cvariable

568Avariable

622Gvariable

637Amostly conserved

646Tmostly conserved

655Tmostly conserved

AATACTATATTTTATATTCGGTGCATGAGCAGGAATATTAGGAACATCTTTTAGTGTTTTAATTCGCACAGAACTAGGAATTCCCGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Lucidota punctatasame family12.2%Lucidota atrasame family13.4%Photinus cookiisame family15.3%Photinus marginellussame family15.7%Photinus knullisame family16.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type1 931 records

Wild obs. + sensor1 819

Museum / vouchered102

Other10

Range

Area of Occupancy AOO4 648 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy55% within 1 km

≤100 m 611≤1 km 226≤10 km 655>10 km 41

1 533 georeferenced · 286 without coordinates

Open the mapobservation + sensor1 819

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy85% within 1 km

≤100 m 43≤1 km 27≤10 km 8>10 km 4

82 georeferenced · 20 without coordinates

Open the institutions mapphysical evidence102

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	61
MZLUlocation not on record	5
Salzburg, AT	4
University of Oulu, Zoological Museumlocation not on record	4
Stockholm, SE	2
Provincia di Livornolocation not on record	2
ZSMlocation not on record	2
Copenhagen, DK	2
Naturalis Biodiversity Centerlocation not on record	1
South Kensington, GB	1
Museu Nacional de História Natural e da Ciêncialocation not on record	1

11 institutions · 85 of 102 vouchered records shown · 17 without an institution code

09Environmental DNA5 detections

Where the DNA of Phosphaenus hemipterus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.20 °C 6.20–15.0

Seasonal swing summer↔winter22.3 °C

Max temp (day)8.90 °C 7.90–16.8

Min temp (night)5.50 °C 4.40–13.1

Precipitation62.8 mm/mo 41.9–76.2

Air humidity60.7 % 58.9–65.5

Moisture balance-61.8 mm/mo -80.2–32.7

Vapour deficit424 Pa 333–696

Wind speed4.80 m/s 3.40–5.20

Cloud cover42.3 % 40.4–58.2

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Phosphaenus hemipterus

At a glance

Sources6 archives

At a glance

Record type1 931 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 11 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 931 records