Phortica variegata

(Fallén, 1823) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Drosophilidae/Phortica

At a glance

Occurrence records229

Data sources9

Biological traits0

DNA specimens54

eDNA detections67

Sources9 archives

Databases and archives Phortica variegata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility229 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI67 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics54 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF229 records

Environmental DNA1 datasets · 8 countries67 detections

DNA & barcodingBOLD54 specimens

Genome at a glanceGoaT · NCBI≈156 Mbp

01Narrative

Phortica variegata (also known as the "variegated fruit fly") is a species of vinegar fly in the family Drosophilidae. Phortica and related fly species are perhaps best known for their behaviour of feeding on the lacrimal secretions of mammals (mammalian tear duct secretions). As a consequence of this behaviour, P. variegata can serve as a vector of Thelazia callipaeda roundworms. The species was first described as Amiota variegata (Fallén, 1823), but has since been clarified as a member of the Phortica genus.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding54 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phortica variegata has left across the world's sequence archives.

At a glance

DNA specimens54

BINs1

Marker genes4

eDNA detections67

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus33 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 14 variable positions, in barcode order

178Tmostly conserved

268Gmostly conserved

289Amostly conserved

313Cmostly conserved

316Amostly conserved

343Tmostly conserved

382Amostly conserved

496Gmostly conserved

508Amostly conserved

550Tmostly conserved

577Amostly conserved

622Amostly conserved

628Amostly conserved

634Tmostly conserved

AACTTTATATTTTATTTTCGGAGCTTGAGCTGGAATAGTTGGAACTTCATTAAGAATTTTAATTCGAGCTGAATTAGGACACCCTGGTGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.64%

Haplotypes11

BIN1

Most divergent pair1.8%

EuropeOtherN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Phortica oldenbergisame genus8.5%Paradelia brunneonigrasame order9.0%Eutrichota tunicatasame order10.1%Pegomya fulgenssame order10.2%Heterostylodes nominabilissame order10.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5PND228S

animal barcodemitochondrialmarker

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_081078 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND1lrRNAsrRNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Phortica variegata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈155 550 413 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Phortica variegata0.16 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness94% BUSCO

08Occurrence & distribution

Record type229 records

Wild obs. + sensor203

Museum / vouchered26

Range

Area of Occupancy AOO472 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 157≤1 km 9≤10 km 14

180 georeferenced · 23 without coordinates

Open the mapobservation + sensor203

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy95% within 1 km

≤100 m 12≤1 km 7>10 km 1

20 georeferenced · 6 without coordinates

Open the institutions mapphysical evidence26

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	11
Tilburg, NL	7
CIBIOlocation not on record	1
Helsinki, FI	1
Natural History Museum, Londonlocation not on record	1

5 institutions · 21 of 26 vouchered records shown · 5 without an institution code

09Environmental DNA67 detections

Where the DNA of Phortica variegata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found67

Studies independent surveys1

Countries8

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 67 detections have coordinates

Open the map8 countries0

1. Forest & Woodland | 1.4. Temperate ForestotherForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.2 °C 14.2–21.4

Seasonal swing summer↔winter18.7 °C

Max temp (day)22.2 °C 17.4–25.4

Min temp (night)13.4 °C 9.00–18.2

Precipitation94.3 mm/mo 56.2–160

Air humidity58.8 % 57.2–64.2

Moisture balance-53.0 mm/mo -63.6–47.3

Vapour deficit764 Pa 584–1,092

Wind speed2.50 m/s 1.60–3.80

Cloud cover38.7 % 33.4–43.5

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)