Phorocera assimilis

(Fallén, 1810) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tachinidae/Phorocera

At a glance

Occurrence records278

Data sources6

Biological traits2

DNA specimens8

eDNA detections66

Sources6 archives

Databases and archives Phorocera assimilis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility278 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI66 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF278 records

Environmental DNA3 datasets · 4 countries66 detections

DNA & barcodingBOLD8 specimens

01Narrative

Phorocera assimilis is een vliegensoort uit de familie van de sluipvliegen (Tachinidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1810 door Fallen.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)parasitoid

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phorocera assimilis has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

eDNA detections66

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

AACTTTATATTTCATTTTTGGAGCATGATCTGGAATAATTGGTACTTCATTAAGTATCTTAATTCGAGCTGAATTAGGACATCCTGGTTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Phorocera grandissame genus1.5%Phorocera obscurasame genus2.4%Tachinomyia nigricanssame family4.1%Phorocera convexasame genus4.1%Phorocera exiguasame genus4.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type278 records

Wild obs. + sensor234

Museum / vouchered42

Other2

Range

Area of Occupancy AOO752 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy48% within 1 km

≤100 m 70≤1 km 40≤10 km 118

228 georeferenced · 6 without coordinates

Open the mapobservation + sensor234

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy83% within 1 km

≤100 m 9≤1 km 20≤10 km 6

35 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence42

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	16
NCMGlocation not on record	6
Gothenburg, SE	3
Provincia di Livornolocation not on record	3
University of Tokyo, Department of Zoologylocation not on record	2
Tilburg, NL	2
South Kensington, GB	2
CBDClocation not on record	1
Iwate Prefectural Museumlocation not on record	1
Helsinki, FI	1

10 institutions · 37 of 42 vouchered records shown · 5 without an institution code

09Environmental DNA66 detections

Where the DNA of Phorocera assimilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found66

Studies independent surveys3

Countries4

Verifiable raw sequence linked45

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 66 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.6 °C 10.4–16.1

Seasonal swing summer↔winter19.0 °C

Max temp (day)15.9 °C 14.8–20.5

Min temp (night)7.20 °C 6.20–10.6

Precipitation50.2 mm/mo 45.1–71.1

Air humidity58.0 % 56.3–60.4

Moisture balance-57.0 mm/mo -65.1–-40.3

Vapour deficit573 Pa 529–798

Wind speed3.30 m/s 2.50–4.30

Cloud cover41.6 % 32.8–47.8

CHELSA 1981–2010, ~9 km grid, at location & month of 66 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)