Phoenix rupicola

T.Anderson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Arecales/Arecaceae/Phoenix

At a glance

Occurrence records29

Data sources9

Biological traits28

DNA specimens0

eDNA detections0

Sources9 archives

Databases and archives Phoenix rupicola's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility29 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources28 traits

Chemical compositionLOTUS4 compounds

Occurrence & distributionGBIF29 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 36

01Narrative

Phoenix rupicola est une espèce de plantes du genre Phoenix et de la famille des Arecaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology7

Fruit length19 mm

Fruit width8 mm

Leaf length max3 100 mm

Plant height6.1 m

Seed mass625 mg

Seed mass max625 mg

Seed mass min625 mg

Life cycle & reproduction4

Deciduousnessevergreen

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Climatewet tropical

Climberself-supporting

Elevation max1 200 m

Elevation min400 m

Epiphyteterrestrial

Fruit colourbrown

Growth formtree

Habitat GIFTcanopy

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits6

Dbh max25 cm

Defenseyes

Leaf spinesyes

Plant support typefree-standing

Shoot length max610 cm

Shoot orientationerect

03Chemical composition4 compounds

Compounds documented for Phoenix rupicola across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Flavones2

Furostane steroids2

Documented compounds4 total

Tissue Source Quantified only

Compound	Amount	Source
(2S,3R,4R,5R,6S)-2-[(2R,3R,4S,5R,6R)-3-hydroxy-2-(hydroxymethyl)-6-[[(1S,2S,4S,6R,7S,8R,9S,12S,13R,16S)-6-methoxy-7,9,13-trimethyl-6-[(3R)-3-methyl-4-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxybutyl]-5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-en-16-yl]oxy]-5-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-4-yl]oxy-6-methyloxane-3,4,5-triol	present	LOTUS
Methyldichotomin	present	LOTUS
Tricin 7-glucoside	present	LOTUS
Vitexin 6''-O-malonyl 2''-O-xyloside	present	LOTUS

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phoenix rupicola has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences10

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK692098.1 ↗480 bp

ACGT

AATTGCAGAATCCCGCGAGCCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCACCAGGCCGAGGGCACGCCTGCCTGGGCGTCACGC …

Phoenix rupicola voucher SCBG109 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL3★ITS4

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Phoenix rupicola carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidydiploid inferred

Chromosome records36–362n range36median36mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 363×CCDB · book-indian_vol2 · CCDB · kew · CCDB · Cave1958

CCDB · book-indian_vol2 — Sarkar, S.K. 1957; Sharma, A.K. &- Sarkar, S.K. 1957a

CCDB · kew — Röser M, Johnson MAT, Hanson L. 1997. Nuclear DNA amounts in palms (Arecaceae). Botanica Acta 110: 79-89.

CCDB · Cave1958 — Sar.,S.K.'57;Shar.&Sar. 1958

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type29 records

Wild obs. + sensor13

Museum / vouchered15

Other1

Range

Area of Occupancy AOO96 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 12

12 georeferenced · 1 without coordinates

Open the mapobservation + sensor13

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 15 records without

Open the institutions mapphysical evidence15

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Université de Bordeauxlocation not on record	3
Paris, FR	2
Blumenau, BR	2
Corrientes, AR	2
TAFORI-LSRClocation not on record	1
Auckland, NZ	1
Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record	1
Miami, US	1

8 institutions · 13 of 15 vouchered records shown · 2 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)