Phoenix atlantica — The Life Data

Plantae/Tracheophyta/Liliopsida/Arecales/Arecaceae/Phoenix

At a glance

Occurrence records32

Data sources7

Biological traits21

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Phoenix atlantica's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility32 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources21 traits

Occurrence & distributionGBIF32 records

DNA & barcodingNCBIsequences

01Narrative

Phoenix atlantica (common name Cape Verde Island date palm, local name: tamareira)Plantas endémicas e arvores indígenas de Cabo Verde is an endangered species in the palm family Arecaceae, in the genus Phoenix. It is endemic to the Cape Verde Islands.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Fruit length20 mm

Fruit width10 mm

Leaf length max3 000 mm

Plant height15 m

Life cycle & reproduction3

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit colourpink

Growth formtree

Habitat GIFTcanopy

Woodinesswoody

Other traits6

Dbh max150 cm

Defenseyes

Leaf spinesyes

Plant support typefree-standing

Shoot length max1 500 cm

Shoot orientationerect

05DNA & barcoding6 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phoenix atlantica has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences6

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK692109.1 ↗479 bp

ACGT

AATTGCAGAATCCCGCGAGCCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCACCAGGCCGAGGGCACGCCTGCCTGGGCGTCACGC …

Phoenix atlantica voucher SCBG041 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK2rbcL2ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type32 records

Wild obs. + sensor17

Museum / vouchered15

Range

Area of Occupancy AOO104 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 17

17 georeferenced

Open the mapobservation + sensor17

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 15 records without

Open the institutions mapphysical evidence15

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	10
Paris, FR	5

2 institutions · 15 of 15 vouchered records shown