Phoenix acaulis

Roxb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Arecales/Arecaceae/Phoenix

At a glance

Occurrence records34

Data sources6

Biological traits20

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Phoenix acaulis's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility34 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources20 traits

Occurrence & distributionGBIF34 records

DNA & barcodingNCBIsequences

01Narrative

Phoenix acaulis (acaulis, Latin, trunkless) the dwarf date palm or stemless date palm, is a species of flowering plant in the palm family, native to northern India, Bhutan and Nepal. Found in altitudes from 350 to 1500 m, Phoenix acaulis grows in scrubland, savannas and in pine forests. Trunks in this species remain underground or, at most, grow to a few inches in height. Leaves are 1.5 m long, gray-green, with 25 cm, pinnately arranged leaflets on short, armed petioles.Riffle, Robert L. and Craft, Paul (2003) An Encyclopedia of Cultivated Palms. Portland: Timber Press. (page 400) /Roxburgh, William. 1819. Plants of the Coast of Coromandel 3: 69, t. 273

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Fruit length20 mm

Fruit length min12 mm

Fruit width8 mm

Leaf length max2 000 mm

Plant height2 m

Life cycle & reproduction3

Life formperennial or subshrub

Life spanperennial

Lifeform raunkiaer detailedchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit colourblack

Growth formtree

Habitat GIFTunderstorey

Woodinesswoody

Other traits3

Defenseyes

Leaf spinesyes

Shoot length max50 cm

05DNA & barcoding6 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phoenix acaulis has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences6

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK692088.1 ↗480 bp

ACGT

AATTGCAGAATCCCGCGAGCCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCACCAGGCCGAGGGCACGCCTGCCTGGGCGTCACGC …

Phoenix acaulis voucher XMBG084 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL3★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type34 records

Wild obs. + sensor11

Museum / vouchered23

Range

Area of Occupancy AOO80 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 6

7 georeferenced · 4 without coordinates

Open the mapobservation + sensor11

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 1

2 georeferenced · 21 without coordinates

Open the institutions mapphysical evidence23

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	9
Miami, US	4
Dehra Dun, IN	4
Universität Göttingenlocation not on record	3
Natural History Museum, Tribhuvan Universitylocation not on record	1
South Kensington, GB	1

6 institutions · 22 of 23 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)