Phlox adsurgens

Torr. ex A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ericales/Polemoniaceae/Phlox

At a glance

Occurrence records406

Data sources11

Biological traits5

DNA specimens1

eDNA detections1

Sources11 archives

Databases and archives Phlox adsurgens's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility406 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources5 traits

Occurrence & distributionGBIF406 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 14

01Narrative

Phlox adsurgens, the northern phlox, is a species of flowering plant in the family Polemoniaceae. It is native to the US, in Oregon and a section of the northern Coast Ranges of California, where it belongs to the flora in forested and wooded mountain habitat. This decumbent herbaceous perennial has erect branches up to 30 cm long. The oval leaves are 1 to long and oppositely arranged in pairs. The inflorescence is a cluster of five-lobed pink flowers. The Latin specific epithet adsurgens means "rising upwards".

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial

Life spanperennial

Habitat & environment3

Climatetemperate

Climberself-supporting

Growth formSubshrub, Forb/herb

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phlox adsurgens has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSKJ159428.1 ↗688 bp

ACGT

CGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTAGCAGAACGACCCGCGAACTTGTATTCAAAACTTGGGTTGTGCGCGCTT …

Phlox adsurgens voucher KANU:00265320 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Phlox adsurgens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 141×CCDB · book-fedorov

CCDB · book-fedorov — Flory 1937a

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type406 records

Wild obs. + sensor271

Museum / vouchered134

Cultivated / captive1

Range

Area of Occupancy AOO1 108 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 159≤1 km 33≤10 km 20>10 km 9

221 georeferenced · 50 without coordinates

Open the mapobservation + sensor271

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy62% within 1 km

≤100 m 3≤1 km 51≤10 km 30>10 km 3

87 georeferenced · 47 without coordinates

Open the institutions mapphysical evidence134

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions21 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Arcata, US	32
Pullman, US	20
Corvallis, US	18
KNFHClocation not on record	5
Canadian Department of Agriculturelocation not on record	4
Claremont, US	4
Davis, US	4
KNFYlocation not on record	3
San Jose, US	3
CASlocation not on record	2
Wuzhou, CN	2
Santa Barbara, US	2
HJAEFlocation not on record	2
US	2
Vancouver, CA	1
Riverside, US	1
Boise, US	1
Brookings, US	1
San Diego, US	1
Tacoma, US	1
Moscow, US	1
Portland, US	1
Chongqing Museumlocation not on record	1
KNFSClocation not on record	1
Severin-McDaniel Insect Collectionlocation not on record	1
Bronx, US	1
Bangkok, TH	1
STNFlocation not on record	1
Fullerton, US	1
Philadelphia, US	1

30 institutions · 119 of 134 vouchered records shown · 15 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Phlox adsurgens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)