Phlomis armeniaca

Willd. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Lamiaceae/Phlomis

At a glance

Occurrence records26

Data sources5

Biological traits12

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Phlomis armeniaca's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility26 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Chemical compositionLOTUS12 compounds

Occurrence & distributionGBIF26 records

DNA & barcodingNCBIsequences

01Narrative

الأذينة الأرمنية نوع نباتي يتبع جنس الأذينة من الفصيلة الشفوية.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass7.7 mg

Seed mass max7.7 mg

Seed mass min7.7 mg

Life cycle & reproduction3

Life formperennial or subshrub

Life spanperennial

Lifeform raunkiaer detailedchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

03Chemical composition12 compounds

Compounds documented for Phlomis armeniaca across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Cinnamic acids and derivatives $ Phenylethanoids8

Iridoids monoterpenoids2

Acyclic monoterpenoids2

Documented compounds12 total

Tissue Source Quantified only

Compound	Amount	Source
(2S,3R,4S,5S,6R)-2-[(3R,6E)-8-hydroxy-3,7-dimethylocta-1,6-dien-3-yl]oxy-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
[(2R,3R,4R,5R,6R)-4-[(2S,3R,4R,5R,6S)-4,5-dihydroxy-6-methyl-3-[(2R,3S,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-2-yl]oxy-6-[2-(3,4-dihydroxyphenyl)ethoxy]-5-hydroxy-2-(hydroxymethyl)oxan-3-yl] (E)-3-(3,4-dihydroxyphenyl)prop-2-enoate	present	LOTUS
[(2R,3R,4R,5R,6R)-6-[2-(3,4-dihydroxyphenyl)ethoxy]-5-hydroxy-2-(hydroxymethyl)-4-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-3-yl] (E)-3-(3-hydroxy-4-methoxyphenyl)prop-2-enoate	present	LOTUS
[4-[4,5-Dihydroxy-6-methyl-3-(3,4,5-trihydroxy-6-methyloxan-2-yl)oxyoxan-2-yl]oxy-6-[2-(3,4-dihydroxyphenyl)ethoxy]-5-hydroxy-2-(hydroxymethyl)oxan-3-yl] 3-(3,4-dihydroxyphenyl)prop-2-enoate	present	LOTUS
Betulalbuside A	present	LOTUS
Forsythoside B	present	LOTUS
Ipolamiide	present	LOTUS
Leucosceptoside A	present	LOTUS
Martynoside	present	LOTUS
methyl (1S,4aR,7S,7aS)-4a,7-dihydroxy-7-methyl-1-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,5,6,7a-tetrahydrocyclopenta[c]pyran-4-carboxylate	present	LOTUS

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phlomis armeniaca has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPQ859620.1 ↗394 bpTurkey · 2024

ACGT

GCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCG …

Phlomis armeniaca voucher KAUITS36 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type26 records

Wild obs. + sensor11

Museum / vouchered13

Other2

Range

Area of Occupancy AOO80 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 8≤1 km 1≤10 km 1

10 georeferenced · 1 without coordinates

Open the mapobservation + sensor11

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 13 records without

Open the institutions mapphysical evidence13

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BGBMlocation not on record	5
Wlocation not on record	2
Salamanca, ES	1
BRNUlocation not on record	1
Barcelona, ES	1
Kew, GB	1
Entomological Society of Latvialocation not on record	1
Bratislava, SK	1

8 institutions · 13 of 13 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)