Phlogophora iris

Guenée, 1852 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Phlogophora

At a glance

Occurrence records2 788

Data sources7

Biological traits0

DNA specimens53

eDNA detections53

Sources7 archives

Databases and archives Phlogophora iris's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 788 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI53 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics53 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 788 records

Environmental DNA1 datasets · 2 countries53 detections

DNA & barcodingBOLD53 specimens

01Narrative

Phlogophora iris, the olive angle shades, is a species of cutworm or dart moth in the family Noctuidae. It is found in North America. The MONA or Hodges number for Phlogophora iris is 9546.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding53 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phlogophora iris has left across the world's sequence archives.

At a glance

DNA specimens53

BINs1

Marker genes1

eDNA detections53

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus50 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

41Gmostly conserved

AACATTATATTTTATTTTTGGGATTTGAGCAGGTATAGTAGGTACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCTGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.66%

Haplotypes5

BIN1

Most divergent pair0.30%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Phlogophora wollastonisame genus3.0%Phlogophora periculosasame genus3.2%Phlogophora interruptasame genus3.6%Bryophila seladonasame family4.4%Phlogophora furnasisame genus4.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 788 records

Wild obs. + sensor2 319

Museum / vouchered469

Range

Area of Occupancy AOO4 916 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 1 445≤1 km 267≤10 km 73>10 km 112

1 897 georeferenced · 422 without coordinates

Open the mapobservation + sensor2 319

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy34% within 1 km

≤100 m 3≤1 km 79≤10 km 146>10 km 12

240 georeferenced · 229 without coordinates

Open the institutions mapphysical evidence469

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	105
East Lansing, US	100
St. Paul, US	65
University of Guelph, Centre for Biodiversity Genomicslocation not on record	35
Cleveland Museum of Natural History, OH (CLEV)location not on record	25
University of Alberta Museums (UAM)location not on record	22
Cambridge, US	16
Royal Saskatchewan Museumlocation not on record	10
Vernal, US	5
Colorado State Universitylocation not on record	5
Toronto, CA	5
Cornell University Insect Collectionlocation not on record	5
Mississippi State, US	4
Georgia Museum of Natural Historylocation not on record	3
SOVTlocation not on record	3
Saint John, CA	2
University of Guelphlocation not on record	1
UDlocation not on record	1
University of California, Davislocation not on record	1

19 institutions · 413 of 469 vouchered records shown · 56 without an institution code

09Environmental DNA53 detections

Where the DNA of Phlogophora iris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found53

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 53 detections have coordinates

Open the map2 countries0

1. Forest & WoodlandRiparian ZoneTemperate mixed forestGrasslandWetlandForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.6 °C 13.6–19.4

Seasonal swing summer↔winter26.4 °C

Max temp (day)21.8 °C 15.5–23.6

Min temp (night)12.6 °C 9.40–16.4

Precipitation86.9 mm/mo 80.0–126

Air humidity61.2 % 57.1–64.4

Moisture balance-53.5 mm/mo -61.2–4.80

Vapour deficit770 Pa 566–866

Wind speed3.60 m/s 2.40–4.00

Cloud cover48.1 % 41.4–55.0

CHELSA 1981–2010, ~9 km grid, at location & month of 53 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Phlogophora iris

At a glance

Sources7 archives

At a glance

Record type2 788 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 19 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 788 records