Philotheca queenslandica

(C.T.White) P.I.Forst. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Rutaceae/Philotheca

At a glance

Occurrence records500

Data sources6

Biological traits17

DNA specimens4

eDNA detections3

Sources6 archives

Databases and archives Philotheca queenslandica's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility500 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources17 traits

Occurrence & distributionGBIF500 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Philotheca queenslandica is a species of flowering plant in the family Rutaceae and is endemic to south-eastern Queensland. It is a wiry shrub with elliptic to egg-shaped leaves with the narrower end toward the base and densely crowded near the ends of the glandular-warty branchlets, and cream-coloured flowers tinged with pink and arranged singly in leaf axils.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRY

Size & morphology6

Fruit length6.5 mm

Leaf length19.5 mm

Leaf mass per area191 g/m2

Leaf size71.86 mm²

Leaf width4.25 mm

Plant height1 m

Life cycle & reproduction3

Life formshrub

Life spanperennial

Sex typehermaphrodite

Habitat & environment6

Climatesubtropical

Fruit fleshinessdry

Fruit typemericarp

Growth formshrub

Leaf shapenarrowly_elliptical narrowly_obovate

Woodinesswoody

Physiology & chemistry2

Specific leaf area (SLA)5.18 mm²/mg

Wood density400 mg/cm³

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Philotheca queenslandica has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences4

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK110002.1 ↗607 bpAustralia

ACGT

CCTGCCTAGCAGAATAACCTGTGAACTTGTTAAAACACCGGAGGGGGCGTGCCCTGTGTGCGCTCCCCTCCTCCTCTGCCTCGGGCGCAG …

Philotheca queenslandica voucher BRI AQ 743513 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS2trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type500 records

Wild obs. + sensor341

Museum / vouchered114

Other45

Origin

Native17

Range

Area of Occupancy AOO692 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 187≤1 km 42≤10 km 31>10 km 11

271 georeferenced · 70 without coordinates

Open the mapobservation + sensor341

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 22≤1 km 17≤10 km 45>10 km 20

104 georeferenced · 10 without coordinates

Open the institutions mapphysical evidence114

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	61
Mount Annan, AU	17
Canberra, AU	14
Museo Entomologico de Leonlocation not on record	9
Armidale, AU	4
Hobart, AU	3
Smithfield, AU	2
John T. Waterhouse Herbariumlocation not on record	1
University of the Sunshine Coastlocation not on record	1
Adelaide, AU	1

10 institutions · 113 of 114 vouchered records shown · 1 without an institution code

09Environmental DNA3 detections

Where the DNA of Philotheca queenslandica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.8 °C 20.8–20.8

Seasonal swing summer↔winter8.90 °C

Max temp (day)24.2 °C

Min temp (night)17.8 °C

Precipitation97.9 mm/mo

Air humidity58.6 %

Moisture balance-43.1 mm/mo

Vapour deficit1,015 Pa

Wind speed2.50 m/s

Cloud cover19.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)