Philotheca pinoides

(Paul G.Wilson) Paul G.Wilson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Rutaceae/Philotheca

At a glance

Occurrence records46

Data sources5

Biological traits21

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Philotheca pinoides's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility46 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources21 traits

Occurrence & distributionGBIF46 records

DNA & barcodingNCBIsequences

01Narrative

Philotheca pinoides is a species of flowering plant in the family Rutaceae and is endemic to the south-west of Western Australia. It is a small, erect undershrub with needle-shaped, glandular-warty leaves and pale pink or red flowers arranged singly or in groups of up to three in the axil of leaves at the end of branchlets.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFT

Size & morphology6

Fruit length6 mm

Leaf length10 mm

Leaf width0.7 mm

Plant height0.45 m

Plant height max0.45 m

Plant height min0.15 m

Life cycle & reproduction4

Flowering timennnnyyyyyynn

Life formsubshrub

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Fruit fleshinessdry

Fruit typemericarp

Growth formshrub

Leaf compoundnesssimple

Leaf shapeacicular

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Philotheca pinoides has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOP524329.1 ↗562 bpAustralia

ACGT

CCTGCCCAGCAGAACGACCCGCGAACCCGTAAACACCGGAGGGTGCGTGCCCAGCGTGCGCTCCCTCCCCTCTGCCTTGGGCGCGGGGCC …

Philotheca pinoides isolate MJB 11 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type46 records

Wild obs. + sensor8

Museum / vouchered38

Origin

Native3

Range

Area of Occupancy AOO132 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 2≤1 km 3≤10 km 1

6 georeferenced · 2 without coordinates

Open the mapobservation + sensor8

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy22% within 1 km

≤100 m 5≤1 km 2≤10 km 18>10 km 7

32 georeferenced · 6 without coordinates

Open the institutions mapphysical evidence38

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	22
Museo Entomologico de Leonlocation not on record	4
Mount Annan, AU	3
Canberra, AU	2
BGPAlocation not on record	2
Parkville, AU	2
Adelaide, AU	1
Hobart, AU	1
Kew, GB	1

9 institutions · 38 of 38 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)