Philotheca nodiflora

(Lindl.) Paul G.Wilson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Rutaceae/Philotheca

At a glance

Occurrence records48

Data sources4

Biological traits20

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Philotheca nodiflora's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility48 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources20 traits

Occurrence & distributionGBIF48 records

DNA & barcodingNCBIsequences

01Narrative

Subsp. lateriticola with butterfly Mesodina cyanophracta Subspecies lasiocalyx flower buds Philotheca nodiflora is a species of flowering plant in the family Rutaceae and is endemic to Western Australia. It is a weak shrub with more or less cylindrical leaves and blue to pink flowers arranged in compact heads.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFT

Size & morphology6

Fruit length3 mm

Leaf length9 mm

Leaf width1 mm

Plant height0.7 m

Plant height max0.8 m

Plant height min0.1 m

Life cycle & reproduction4

Flowering timeynnnnnnyyyyy

Life formsubshrub

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Fruit fleshinessdry

Fruit typemericarp

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: shrub

Leaf compoundnesssimple

Leaf shapeterete

Woodinesswoody

⚠ sources differ — AusTraits: woody · GIFT: non-woody

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Philotheca nodiflora has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOP524327.1 ↗601 bpAustralia

ACGT

CCTGCCCAGCAGAACGACCCGCGAACTCGTGAAAACACCGGAGGGGGCGTGCCTTGCGTGCGCTCCTTTCCCCCCTGCCCGAGCGCAGGC …

Philotheca nodiflora subsp. lasiocalyx isolate MJB 1962 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type48 records

Wild obs. + sensor28

Museum / vouchered18

Cultivated / captive2

Origin

Native3

Range

Area of Occupancy AOO144 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy52% within 1 km

≤100 m 8≤1 km 4≤10 km 5>10 km 6

23 georeferenced · 5 without coordinates

Open the mapobservation + sensor28

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤100 m 2≤1 km 2≤10 km 6>10 km 5

15 georeferenced · 3 without coordinates

Open the institutions mapphysical evidence18

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 1 without coordinates

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	6
Kensington, AU	4
Mount Annan, AU	3
Adelaide, AU	3
Boise, US	1
Parkville, AU	1

6 institutions · 18 of 18 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)