Philotheca myoporoides

(DC.) Bayly · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Rutaceae/Philotheca

At a glance

Occurrence records638

Data sources10

Biological traits33

DNA specimens8

eDNA detections8

Sources10 archives

Databases and archives Philotheca myoporoides's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility638 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources33 traits

Chemical compositionLOTUS · NPASS32 compounds

Occurrence & distributionGBIF638 records

Environmental DNA1 datasets · 0 countries8 detections

DNA & barcodingBOLD · NCBI8 specimens

01Narrative

Habit of subsp. myoporoides Subspecies acuta in the ANBG Subspecies brevipedunculata in the ANBG Philotheca myoporoides, commonly known as long-leaf wax flower, is a species of flowering plant in the family Rutaceae and is endemic to south-eastern Australia. It is a shrub with sessile, oblong to egg-shaped, glandular-warty leaves and white to pink flowers arranged singly in leaf axils. Prior to 1998 it was known as Eriostemon myoporoides.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFT

Size & morphology13

Fruit length7 mm

Leaf length110 mm

Leaf length max110 mm

Leaf length min13 mm

Leaf width20 mm

Leaf width max22 mm

Leaf width min4 mm

Plant height2.25 m

Plant height max2.5 m

Seed length4.25 mm

Seed mass8.01 mg

Seed mass max8.01 mg

Seed mass min8.01 mg

Life cycle & reproduction7

Dispersal typeanimal

Flowering timennyyynnnyyyn

Life formshrub

Life spanperennial

Pollination syndromeinsect

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typemericarp

Growth formshrub

Leaf compoundnesssimple

Leaf shapefalcate oblong ovate widely_elliptical widely_obovate

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

03Chemical composition32 compounds

Compounds documented for Philotheca myoporoides across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Cycloartane triterpenoids8

Guaiane sesquiterpenoids4

Pyranocoumarins $ Simple coumarins4

Flavones4

Miscellaneous meroterpenoids2

Documented compounds32 total

Tissue Source Quantified only

Compound	Amount	Source
(12R,15R,16R,17S)-16-[(2S)-3,3-dimethyloxirane-2-carbonyl]-11,11,15-trimethyl-6,10,19-trioxapentacyclo[13.3.1.02,7.09,18.012,17]nonadeca-1,3,7,9(18)-tetraen-5-one	present	LOTUS
(12R,15S,16R,17R)-11,11,15-trimethyl-16-(3-methylbut-2-enoyl)-6,10,19-trioxapentacyclo[13.3.1.02,7.09,18.012,17]nonadeca-1,3,7,9(18)-tetraen-5-one	present	LOTUS
(12R,15S,16R,17R)-16-[(E)-3-hydroperoxy-3-methylbut-1-enyl]-11,11,15-trimethyl-6,10,19-trioxapentacyclo[13.3.1.02,7.09,18.012,17]nonadeca-1,3,7,9(18)-tetraen-5-one	present	LOTUS
(12R,15S,16S,17R)-11,11,15-trimethyl-16-[(1R,2R)-1,2,3-trihydroxy-3-methylbutyl]-6,10,19-trioxapentacyclo[13.3.1.02,7.09,18.012,17]nonadeca-1,3,7,9(18)-tetraen-5-one	present	LOTUS
(1S,2S,6S,12S,14R)-9,14-dimethyl-5-methylidene-3,13-dioxatetracyclo[8.4.0.02,6.012,14]tetradec-9-en-4-one	present	NPASS
(1S,3R,6S,8R,11S,12S,15R,16R)-15-(6-hydroxy-6-methylhept-1-en-2-yl)-7,7,12,16-tetramethylpentacyclo[9.7.0.01,3.03,8.012,16]octadecan-6-ol	present	NPASS
(1S,3R,6S,8R,11S,12S,15R,16R)-15-[(2S,3S)-3-hydroxy-6-methylhept-6-en-2-yl]-7,7,12,16-tetramethylpentacyclo[9.7.0.01,3.03,8.012,16]octadecan-6-ol	present	NPASS
(1S,3S,5R,6R,8R,11S,12S,15R,16R)-15-[(2S,3R,4E)-3-hydroxy-6-methylhepta-4,6-dien-2-yl]-7,7,12,16-tetramethylpentacyclo[9.7.0.01,3.03,8.012,16]octadecane-5,6-diol	present	NPASS
(1S,3S,5R,6R,8R,11S,12S,15S,16R)-15-[(3R)-3-hydroxy-6-methylhepta-1,6-dien-2-yl]-7,7,12,16-tetramethylpentacyclo[9.7.0.01,3.03,8.012,16]octadecane-5,6-diol	present	NPASS
(2R,3S,4S)-2-[(1S,3R,6S,8R,11S,12S,15R,16R)-6-hydroxy-7,7,12,16-tetramethyl-15-pentacyclo[9.7.0.01,3.03,8.012,16]octadecanyl]-6-methyl-5-methylidenehept-6-ene-1,3,4-triol	present	NPASS

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Philotheca myoporoides has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes2

GenBank sequences10

eDNA detections8

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK109982.1 ↗562 bpAustralia

ACGT

GGCGTGCCTTGCGTACGCTCCCCTCCCCCTCTGCCTTGGGCGCAGGGCTTGTCCCGGCTACCTTGGCAGAACAACGAACCCCCGGCGCGG …

Philotheca myoporoides subsp. myoporoides voucher MELU D105810 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS9

plant barcodefungal barcode

08Occurrence & distribution

Record type638 records

Wild obs. + sensor493

Museum / vouchered143

Other2

Origin

Native9

Introduced1

Range

Area of Occupancy AOO1 508 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 291≤1 km 64≤10 km 28>10 km 9

392 georeferenced · 101 without coordinates

Open the mapobservation + sensor493

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy37% within 1 km

≤100 m 14≤1 km 8≤10 km 21>10 km 17

60 georeferenced · 83 without coordinates

Open the institutions mapphysical evidence143

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Parkville, AU	72
Brisbane, AU	29
Museo Entomologico de Leonlocation not on record	9
Mount Annan, AU	8
Canberra, AU	6
John T. Waterhouse Herbariumlocation not on record	3
NSW Dept of Planning, Industry and Environmentlocation not on record	2
La Trobe Universitylocation not on record	2
Batemans Bay, AU	2
Rotorua, NZ	2
James Cook Townsvillelocation not on record	1
Kew, GB	1
Wollongong, AU	1
Long Beach, US	1
Pondicherry, IN	1
Adelaide, AU	1
Santa Cruz, US	1
Armidale, AU	1

18 institutions · 143 of 143 vouchered records shown

09Environmental DNA8 detections

Where the DNA of Philotheca myoporoides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)