Philotheca hispidula

(Spreng.) Paul G.Wilson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Rutaceae/Philotheca

At a glance

Occurrence records1 071

Data sources10

Biological traits32

DNA specimens1

eDNA detections1

Sources10 archives

Databases and archives Philotheca hispidula's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 071 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources32 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF1 071 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 28

01Narrative

Philotheca hispidula is a flowering plant in the citrus family and is endemic to New South Wales. It is a small shrub with narrow egg-shaped to wedge-shaped leaves that are glandular-wavy on the edges, and white or pale pink flowers arranged singly in leaf axils.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology12

Fruit length7 mm

Leaf length15 mm

Leaf length max35 mm

Leaf length min10 mm

Leaf width3.5 mm

Leaf width max4 mm

Leaf width min3 mm

Plant height1 m

Plant height max1 m

Seed mass10.32 mg

Seed mass max10.32 mg

Seed mass min10.32 mg

Life cycle & reproduction8

Dispersal typeself

Flowering timennnnnnnnyynn

Life formshrub

Life spanperennial

Lifespan years15 years

Reproductive maturity3 years

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typemericarp

Growth formshrub

Leaf compoundnesssimple

Leaf shapenarrowly_obovate obtriangular

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

03Chemical composition1 compounds

Compounds documented for Philotheca hispidula across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Flavonols1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Eriostemin		present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Philotheca hispidula has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK109970.1 ↗606 bpAustralia

ACGT

CCTGCCTAGCAGTACAACCTGTGAACTCGTGAAAACACTGGAGGGGGCGTGCCCTGCGTACGCTCCCCTCCCCCTCTACCTCGGGCGCAG …

Philotheca hispidula voucher MEL 239673 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Philotheca hispidula carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidydiploid inferred

Chromosome records28–282n range28median28mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 282×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-fedorov — Smith-White

CCDB · book-atlas-flowering-plants

n 141×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Stace, H. M. & J. A. Armstrong. 1992. New chromosome numbers for Rutaceae. Austral. Syst. Bot. 5: 501–505.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 071 records

Wild obs. + sensor876

Museum / vouchered194

Cultivated / captive1

Origin

Native104

Range

Area of Occupancy AOO1 628 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 601≤1 km 112≤10 km 44>10 km 11

768 georeferenced · 108 without coordinates

Open the mapobservation + sensor876

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 18≤1 km 34≤10 km 97>10 km 12

161 georeferenced · 33 without coordinates

Open the institutions mapphysical evidence194

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	104
Canberra, AU	27
Museo Entomologico de Leonlocation not on record	26
Adelaide, AU	10
Armidale, AU	6
Batemans Bay, AU	5
Wollongong, AU	4
John T. Waterhouse Herbariumlocation not on record	3
Hobart, AU	2
Parkville, AU	2
Kensington, AU	1
Kew, GB	1
Museo Nacional de Costa Rica (MNCR)location not on record	1
NSW Dept of Planning, Industry and Environmentlocation not on record	1
Smithfield, AU	1

15 institutions · 194 of 194 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Philotheca hispidula was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Philotheca hispidula

At a glance

Sources10 archives

Size & morphology12

Life cycle & reproduction8

Diet & foraging1

Habitat & environment10

Physiology & chemistry1

Compound class profile1 class

Documented compounds1 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 071 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions11 of 15 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type1 071 records