Philotheca glasshousiensis

(Domin) P.I.Forst. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Rutaceae/Philotheca

At a glance

Occurrence records111

Data sources6

Biological traits13

DNA specimens2

eDNA detections2

Sources6 archives

Databases and archives Philotheca glasshousiensis's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility111 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources13 traits

Occurrence & distributionGBIF111 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Philotheca glasshousiensis is a species of flowering plant in the family Rutaceae and is endemic to Queensland. It is a shrub with densely glandular-warty branchlets, lance-shaped to wedge-shaped leaves clustered near the ends of the branchlets and cream-coloured flowers arranged singly or in groups of up to five.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraits

Size & morphology4

Fruit length9 mm

Leaf length36 mm

Leaf width8 mm

Plant height1 m

Life cycle & reproduction3

Life formshrub

Life spanperennial

Sex typehermaphrodite

Habitat & environment6

Climateseasonally dry tropical

Fruit fleshinessdry

Fruit typemericarp

Growth formshrub

Leaf shapeoblanceolate oblong

Woodinesswoody

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Philotheca glasshousiensis has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences3

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK109969.1 ↗607 bpAustralia

ACGT

CCTGCCTAGCAGTACAACCTGTGAACTCGTGAAAACACCGGAGGGGGTGTGCCCTGCGTACTCTCCCCTCCCCCTCTACCTCGGGCGCAG …

Philotheca glasshousiensis voucher BRI AQ0846033 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS3

fungal barcode

08Occurrence & distribution

Record type111 records

Wild obs. + sensor28

Museum / vouchered75

Other8

Origin

Native11

Range

Area of Occupancy AOO120 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 13≤1 km 6≤10 km 4

23 georeferenced · 5 without coordinates

Open the mapobservation + sensor28

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy74% within 1 km

≤100 m 39≤1 km 14≤10 km 16>10 km 3

72 georeferenced · 3 without coordinates

Open the institutions mapphysical evidence75

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	41
Museo Entomologico de Leonlocation not on record	12
Mount Annan, AU	11
Canberra, AU	4
Hobart, AU	3
Armidale, AU	3
Kensington, AU	1

7 institutions · 75 of 75 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Philotheca glasshousiensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)