Philotheca gardneri

(Paul G.Wilson) Paul G.Wilson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Rutaceae/Philotheca

At a glance

Occurrence records42

Data sources4

Biological traits17

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Philotheca gardneri's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility42 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources17 traits

Occurrence & distributionGBIF42 records

DNA & barcodingNCBIsequences

01Narrative

Philotheca gardneri is a species of flowering plant in the family Rutaceae and is endemic to the south-west of Western Australia. It is a shrub with crowded, narrow club-shaped or more or less spherical leaves and white flowers with a prominent pink midrib, usually borne singly on the ends of branchlets.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFT

Size & morphology4

Leaf length6.5 mm

Plant height1 m

Plant height max1.5 m

Plant height min0.25 m

Life cycle & reproduction4

Flowering timennnyyyyyyynn

Life formsubshrub

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Fruit fleshinessdry

Fruit typemericarp

Growth formshrub

Leaf shapespathulate terete

Woodinesswoody

05DNA & barcoding5 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Philotheca gardneri has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMW824645.1 ↗597 bp

ACGT

CTAGCAGAACAACCCGTGAACTCGTGAAAACACCGGAGGGGGTGTGCCCTGTGCTCGCTCCCTCCCCTTCTGCCTCGGGCGCGGGGCTTG …

Philotheca gardneri voucher Bayly 1949 (MEL) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL3★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type42 records

Wild obs. + sensor5

Museum / vouchered37

Origin

Native1

Range

Area of Occupancy AOO108 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 4≤10 km 1

5 georeferenced

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 11≤1 km 4≤10 km 14>10 km 3

32 georeferenced · 5 without coordinates

Open the institutions mapphysical evidence37

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	15
Kensington, AU	12
Adelaide, AU	3
Palmerston, AU	2
Kew, GB	1
Brisbane, AU	1
Mount Annan, AU	1
BGPAlocation not on record	1

8 institutions · 36 of 37 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)