Philotheca freyciana

Rozefelds · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Rutaceae/Philotheca

At a glance

Occurrence records44

Data sources4

Biological traits17

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Philotheca freyciana's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility44 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources17 traits

Occurrence & distributionGBIF44 records

DNA & barcodingNCBIsequences

01Narrative

Philotheca freyciana, commonly known as the Freycinet waxflower, is a species of flowering plant in the family Rutaceae and is endemic to a small area of Tasmania. It is a small, erect shrub with intertwined, heart-shaped to egg-shaped leaves with the narrower end at the base, and white, five-petalled flowers arranged singly in leaf axils.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRY

Size & morphology6

Fruit length4 mm

Fruit width3.5 mm

Leaf length13 mm

Leaf width11 mm

Plant height0.4 m

Seed mass5.05 mg

Life cycle & reproduction3

Flowering timeynnnnnnnnnnn

Life spanperennial

Sex typehermaphrodite

Habitat & environment7

Climatetemperate

Fruit fleshinessdry

Fruit typemericarp

Growth formshrub

Leaf compoundnesssimple

Leaf shapeobcordate obovate

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Philotheca freyciana has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK109992.1 ↗694 bpAustralia

ACGT

GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTAGCAGTACAACCCGTGAACTTGTGAAAACACCGGAG …

Philotheca freyciana voucher MELU D108699 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type44 records

Wild obs. + sensor32

Museum / vouchered12

Range

Area of Occupancy AOO32 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 25≤1 km 5≤10 km 2

32 georeferenced

Open the mapobservation + sensor32

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy91% within 1 km

≤100 m 1≤1 km 9≤10 km 1

11 georeferenced · 1 without coordinates

Open the institutions mapphysical evidence12

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Hobart, AU	9
Parkville, AU	1
Museo Entomologico de Leonlocation not on record	1
Canberra, AU	1

4 institutions · 12 of 12 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)