Philotheca epilosa

(Paul G.Wilson) P.I.Forst. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Rutaceae/Philotheca

At a glance

Occurrence records307

Data sources6

Biological traits30

DNA specimens1

eDNA detections1

Sources6 archives

Databases and archives Philotheca epilosa's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility307 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources30 traits

Occurrence & distributionGBIF307 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Philotheca epilosa is a species of flowering plant in the family Rutaceae and is endemic to eastern Australia. It is a shrub with egg-shaped to lance-shaped leaves with the narrower end toward the base and crowded near the ends of the glandular-warty branchlets, and white flowers usually arranged singly on the ends of the branchlets.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFT

Size & morphology9

Fruit length7 mm

Leaf length20 mm

Leaf length max30 mm

Leaf length min15 mm

Leaf width6.5 mm

Leaf width max10 mm

Leaf width min5 mm

Plant height1.5 m

Plant height max2 m

Life cycle & reproduction8

Dispersal typeanimal

Flowering timennyyynnnyyyn

Life formshrub

Life spanperennial

Pollination syndromeinsect

Reproductive maturity7 years

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typemericarp

Growth formshrub

Leaf compoundnesssimple

Leaf shapeoblanceolate obovate

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Philotheca epilosa has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK109995.1 ↗589 bpAustralia

ACGT

CCTGCCTAGCAGTACAACCGTGAACTCGTGAAAACACCGGAGGGGGGTGCCCTGCGTAGCTCCCCTCCCCCTCTGACTCGGGCGCAGGGC …

Philotheca epilosa voucher BRI AQ0745288 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type307 records

Wild obs. + sensor173

Museum / vouchered133

Other1

Origin

Native27

Range

Area of Occupancy AOO328 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 137≤1 km 10>10 km 4

151 georeferenced · 22 without coordinates

Open the mapobservation + sensor173

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 24≤1 km 22≤10 km 33>10 km 4

83 georeferenced · 50 without coordinates

Open the institutions mapphysical evidence133

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Armidale, AU	39
Brisbane, AU	30
Mount Annan, AU	27
Canberra, AU	17
Museo Entomologico de Leonlocation not on record	12
Kensington, AU	2
NSW Dept of Planning, Industry and Environmentlocation not on record	2
Hobart, AU	2
John T. Waterhouse Herbariumlocation not on record	1
Parkville, AU	1

10 institutions · 133 of 133 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Philotheca epilosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)