Philotheca difformis

(A.Cunn. ex Endl.) Paul G.Wilson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Rutaceae/Philotheca

At a glance

Occurrence records115

Data sources6

Biological traits32

DNA specimens3

eDNA detections1

Sources6 archives

Databases and archives Philotheca difformis's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility115 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources32 traits

Occurrence & distributionGBIF115 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Subspecies smithiana in the ANBG Habit of subspecies difformis near Goolgowi Subspecies smithiana flower and foliage Philotheca difformis is a species of flowering plant in the family Rutaceae and is endemic to continental eastern Australia. It is a shrub with variably-shaped leaves depending on subspecies, and white flowers arranged singly or in groups of up to four on the ends of the branchlets. Subspecies difformis is commonly known as the small-leaf wax-flower.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFT

Size & morphology12

Fruit length5 mm

Leaf length4 mm

Leaf mass per area254 g/m2

Leaf size7 mm²

Leaf width2 mm

Leaf width max4 mm

Petiole length0.1 cm

Plant height1 m

Plant height max2 m

Plant height min0.5 m

Seed length3.25 mm

Seed mass2 mg

Life cycle & reproduction7

Dispersal typeanimal

Flowering timennnnnnnnyyyn

Life formsubshrub

Life spanperennial

Pollination syndromeinsect

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typemericarp

Growth formshrub

Leaf compoundnesssimple

Leaf shapeovate rhomboidal terete

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Philotheca difformis has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences4

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOP524325.1 ↗699 bpAustralia

ACGT

GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTAGCAGAACAACCCGCGAACCCGTGAAAACACCGGAG …

Philotheca difformis subsp. smithiana isolate R133 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★ITS1trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type115 records

Wild obs. + sensor81

Museum / vouchered29

Other5

Origin

Native10

Range

Area of Occupancy AOO312 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 50≤1 km 7≤10 km 14>10 km 1

72 georeferenced · 9 without coordinates

Open the mapobservation + sensor81

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy81% within 1 km

≤100 m 13≤1 km 4≤10 km 3>10 km 1

21 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence29

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	9
Museo Entomologico de Leonlocation not on record	3
Armidale, AU	3
Adelaide, AU	3
Brisbane, AU	2
Kew, GB	2
John T. Waterhouse Herbariumlocation not on record	1
Hobart, AU	1
Parkville, AU	1
NSW Dept of Planning, Industry and Environmentlocation not on record	1
University of the Sunshine Coastlocation not on record	1
Christchurch, NZ	1

12 institutions · 28 of 29 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Philotheca difformis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.1 °C 24.1–24.1

Seasonal swing summer↔winter10.3 °C

Max temp (day)27.9 °C

Min temp (night)20.6 °C

Precipitation169 mm/mo

Air humidity63.5 %

Moisture balance7.00 mm/mo

Vapour deficit1,092 Pa

Wind speed2.20 m/s

Cloud cover30.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)