Philotheca deserti

(E.Pritz.) Paul G.Wilson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Rutaceae/Philotheca

At a glance

Occurrence records37

Data sources4

Biological traits18

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Philotheca deserti's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility37 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources18 traits

Occurrence & distributionGBIF37 records

DNA & barcodingNCBIsequences

01Narrative

Philotheca deserti is a species of flowering plant in the family Rutaceae and is endemic to inland Western Australia. It is an erect shrub with narrow spindle-shaped, glandular-warty leaves and white flowers arranged singly in leaf axils.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFT

Size & morphology5

Fruit length2.5 mm

Leaf length25 mm

Plant height1.5 m

Plant height max2 m

Plant height min0.3 m

Life cycle & reproduction4

Flowering timennnyyyyyyynn

Life formshrub

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Fruit fleshinessdry

Fruit typemericarp

Growth formshrub

Leaf shapesubulate

Woodinesswoody

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Philotheca deserti has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOP524324.1 ↗609 bpAustralia

ACGT

CCTGCCTAGCAGAACAACCCGCGAACTCGTGAAAACACCGGAGGGGGTGCGCCCTGTGCTCGCTCCCTCCCCTTCTGCCTCGGGCGTGGG …

Philotheca deserti subsp. deserti isolate MJB 1919 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type37 records

Wild obs. + sensor5

Museum / vouchered32

Origin

Native4

Range

Area of Occupancy AOO124 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 3≤1 km 1≤10 km 1

5 georeferenced

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy37% within 1 km

≤100 m 3≤1 km 7≤10 km 15>10 km 2

27 georeferenced · 5 without coordinates

Open the institutions mapphysical evidence32

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	11
Adelaide, AU	6
Kensington, AU	5
Mount Annan, AU	3
Canberra, AU	2
Brisbane, AU	1
Hobart, AU	1
Christchurch, NZ	1
Palmerston, AU	1

9 institutions · 31 of 32 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)