Philotheca coccinea

(C.A.Gardner) Paul G.Wilson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Rutaceae/Philotheca

At a glance

Occurrence records87

Data sources8

Biological traits19

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Philotheca coccinea's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility87 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources19 traits

Chemical compositionLOTUS10 compounds

Occurrence & distributionGBIF87 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Philotheca coccinea is a species of flowering plant in the family Rutaceae and is endemic to Western Australia. It is a shrub with club-shaped leaves that are warty on the lower surface, and red to pink flowers arranged singly in leaf axils.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFT

Size & morphology5

Leaf length10 mm

Leaf width1.5 mm

Plant height1 m

Plant height max1 m

Plant height min0.3 m

Life cycle & reproduction4

Flowering timennnnnnyyyynn

Life formsubshrub

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Fruit fleshinessdry

Fruit typemericarp

Growth formshrub

Leaf compoundnesssimple

Leaf shapespathulate

Woodinesswoody

03Chemical composition10 compounds

Compounds documented for Philotheca coccinea across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Pyranocoumarins3

Quinoline alkaloids2

Pyranocoumarins $ Simple coumarins2

Merohemiterpenoids1

Documented compounds10 total

Tissue Source Quantified only

Compound	Amount	Source
3-[5,7-Dimethoxy-2,2-dimethyl-6-(3-methylbuta-1,3-dienyl)chromen-8-yl]propanoic acid	present	LOTUS
3-[5,7-dimethoxy-2,2-dimethyl-6-[(1Z)-3-methylbuta-1,3-dienyl]chromen-8-yl]propanoic acid	present	LOTUS
5-Methoxy-2,2-dimethyl-6-(3-methylbuta-1,3-dienyl)pyrano[2,3-h]chromen-8-one	present	LOTUS
5-methoxy-2,2-dimethyl-6-[(1E)-3-methylbuta-1,3-dienyl]pyrano[2,3-h]chromen-8-one	present	LOTUS
6-(3-Hydroxy-3-methylbut-1-enyl)-5-methoxy-2,2-dimethylpyrano[2,3-h]chromen-8-one	present	LOTUS
Avicennol	present	LOTUS
Cis-Avicennol	present	LOTUS
Eriostoic acid	present	LOTUS
Gamma-Fagarine	present	LOTUS
Maculosidine	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Philotheca coccinea has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK109994.1 ↗609 bpAustralia

ACGT

CCTGCCTAGCAGAACAACCCGCGAACTAGTGAAAACACCGGAGGGGTGCGCCCTGTGCTCGCTCCCTCCCCTTCTGCCTCGGGCGCGCGC …

Philotheca coccinea voucher MEL 2383614 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type87 records

Wild obs. + sensor10

Museum / vouchered76

Cultivated / captive1

Origin

Native5

Range

Area of Occupancy AOO176 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 6≤1 km 1>10 km 1

8 georeferenced · 2 without coordinates

Open the mapobservation + sensor10

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy39% within 1 km

≤100 m 15≤1 km 10≤10 km 36>10 km 3

64 georeferenced · 12 without coordinates

Open the institutions mapphysical evidence76

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	35
Adelaide, AU	9
Canberra, AU	8
Museo Entomologico de Leonlocation not on record	7
Mount Annan, AU	5
BGPAlocation not on record	5
Brisbane, AU	2
Hobart, AU	2
Kew, GB	1
Joondalup, AU	1

10 institutions · 75 of 76 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Philotheca coccinea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)