Philotheca buxifolia

(Sm.) Paul G.Wilson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Rutaceae/Philotheca

At a glance

Occurrence records535

Data sources8

Biological traits34

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Philotheca buxifolia's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility535 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources34 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF535 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Pink flowers in bloom on Middle Head, Sydney Philotheca buxifolia is a species of flowering plant in the family Rutaceae and is endemic to New South Wales. It is a shrub with more or less oblong leaves and solitary white to pink flowers arranged singly on the ends of branchlets.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFT

Size & morphology14

Fruit length7 mm

Leaf length9 mm

Leaf length max18 mm

Leaf length min6 mm

Leaf mass per area244 g/m2

Leaf size32 mm²

Leaf width7.5 mm

Leaf width max12 mm

Leaf width min3 mm

Plant height1 m

Plant height max0.3 m

Seed mass11.52 mg

⚠ sources differ — AusTraits: 11.52 mg · GIFT: 8.36 mg

Seed mass max8.36 mg

Seed mass min8.36 mg

Life cycle & reproduction8

Dispersal typeanimal+self

Flowering timennnnnnnyyyyn

Life formshrub

Life spanperennial

Lifespan years25 years

Reproductive maturity4.5 years

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typemericarp

Growth formshrub

Leaf compoundnesssimple

Leaf shapeobovate orbicular widely_elliptical

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

03Chemical composition1 compounds

Compounds documented for Philotheca buxifolia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Flavonols1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Eriostemin		present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Philotheca buxifolia has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences4

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK109967.1 ↗586 bpAustralia

ACGT

CCTAGCAGTACAACCGTGAACTCGTGAAAACACGGAGGGGGCGTGCCTGCGTACGCTCCCCTCCCCCTCTCCTGGGCGCAGGGCTTGTCC …

Philotheca buxifolia subsp. buxifolia voucher MELU D105835 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type535 records

Wild obs. + sensor481

Museum / vouchered53

Cultivated / captive1

Origin

Native7

Range

Area of Occupancy AOO640 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 326≤1 km 38≤10 km 38

402 georeferenced · 79 without coordinates

Open the mapobservation + sensor481

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 9≤1 km 5≤10 km 19>10 km 11

44 georeferenced · 9 without coordinates

Open the institutions mapphysical evidence53

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	20
Canberra, AU	9
Adelaide, AU	8
Mount Annan, AU	6
NSW Dept of Planning, Industry and Environmentlocation not on record	5
Christchurch, NZ	2
Parkville, AU	1
University of Stellenboschlocation not on record	1
Rotorua, NZ	1

9 institutions · 53 of 53 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Philotheca buxifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)