Philotheca angustifolia

(Paul G.Wilson) Paul G.Wilson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Rutaceae/Philotheca

At a glance

Occurrence records176

Data sources4

Biological traits34

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Philotheca angustifolia's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility176 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources34 traits

Occurrence & distributionGBIF176 records

DNA & barcodingNCBIsequences

01Narrative

Subspecies angustifolia near Elmore Philotheca angustifolia, commonly known as narrow-leaf wax flower, is a species of flowering plant in the family Rutaceae and is endemic to south-eastern Australia. It is a shrub with small leaves and white flowers with five egg-shaped petals in spring.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFT

Size & morphology14

Fruit length3 mm

Leaf length10 mm

Leaf length max10 mm

Leaf length min2 mm

Leaf width1.5 mm

Leaf width max1 mm

Petiole length0.1 cm

Plant height0.55 m

Plant height max2 m

Plant height min0.3 m

Seed length2.5 mm

Seed mass2.06 mg

Seed mass max2.05 mg

Seed mass min2.05 mg

Life cycle & reproduction7

Dispersal typeanimal

Flowering timennnnnnnnyyyn

Life formsubshrub

Life spanperennial

Pollination syndromeinsect

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typemericarp

Growth formshrub

Leaf compoundnesssimple

Leaf shapeorbicular spathulate terete

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Philotheca angustifolia has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOP524321.1 ↗610 bpAustralia

ACGT

CCTGCCTAGCAGAAAACCCGCGAACTCGTGAAAACACCGGAGGGGGTGCGCCCTGTGCTCGCTCCCTCCCCTTCTGCCTCGGGCGCGGGG …

Philotheca angustifolia subsp. angustifolia isolate MJB 1990 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type176 records

Wild obs. + sensor149

Museum / vouchered27

Origin

Native9

Range

Area of Occupancy AOO388 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 77≤1 km 28≤10 km 9>10 km 7

121 georeferenced · 28 without coordinates

Open the mapobservation + sensor149

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy57% within 1 km

≤100 m 7≤1 km 1≤10 km 6

14 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence27

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	8
Kew, GB	4
Parkville, AU	4
Canberra, AU	3
Stockholm, SE	2
EL PASO, US	1
John T. Waterhouse Herbariumlocation not on record	1
Mount Annan, AU	1
Christchurch, NZ	1

9 institutions · 25 of 27 vouchered records shown · 2 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)