Philodromus praelustris

Keyserling, 1880 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Philodromidae/Philodromus

At a glance

Occurrence records115

Data sources8

Biological traits4

DNA specimens96

eDNA detections97

Sources8 archives

Databases and archives Philodromus praelustris's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility115 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI97 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics96 specimens↗

World Spider Trait DBMasaryk University4 traits · 2 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources4 traits

Occurrence & distributionGBIF115 records

Environmental DNA1 datasets · 2 countries97 detections

DNA & barcodingBOLD96 specimens

01Narrative

Philodromus praelustris is a species of running crab spider in the family Philodromidae. It is found in the United States and Canada.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesDondale & Redner 1978Pekár et al. 2012a

Morphometry3

Body length♀8·♂5.9 mm

Cephalothorax length3.2 mm

Cephalothorax width3.3 mm

Predation1

Prey diversity5.85 mm

05DNA & barcoding96 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Philodromus praelustris has left across the world's sequence archives.

At a glance

DNA specimens96

BINs1

Marker genes1

eDNA detections97

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus80 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 16 variable positions, in barcode order

40Tmostly conserved

199Gmostly conserved

256Tmostly conserved

274Tmostly conserved

313Gmostly conserved

337Tmostly conserved

412Gmostly conserved

466Gmostly conserved

478Gmostly conserved

553Cvariable

592Amostly conserved

595Tmostly conserved

604Cmostly conserved

607Amostly conserved

616Cmostly conserved

634Tmostly conserved

GACATTATATTTAATTTTTGGAGCATGAGCAGCAATAGTTGGAACAGCAATAAGTATATTAATTCGAATAGAATTAGGTCAAGTAGGAAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes21

BIN1

Most divergent pair2.3%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Philodromus vulgarissame genus5.0%Philodromus longipalpissame genus8.0%Philodromus praedatussame genus8.2%Philodromus keyserlingisame genus8.4%Philodromus cespitumsame genus8.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type115 records

Wild obs. + sensor13

Museum / vouchered102

Range

Area of Occupancy AOO304 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 9≤1 km 1≤10 km 1>10 km 1

12 georeferenced · 1 without coordinates

Open the mapobservation + sensor13

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 6≤1 km 1≤10 km 8

15 georeferenced · 87 without coordinates

Open the institutions mapphysical evidence102

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	42
Cambridge, US	14
Albuquerque, US	5
Edmonton, CA	5
Biodiversity Institute of Ontariolocation not on record	4
Denver, US	2
University of Alberta Museums (UAM)location not on record	1
Centre for Biodiversity Genomicslocation not on record	1
Royal Saskatchewan Museumlocation not on record	1
Saint John, CA	1

10 institutions · 76 of 102 vouchered records shown · 26 without an institution code

09Environmental DNA97 detections

Where the DNA of Philodromus praelustris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found97

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 97 detections have coordinates

Open the map2 countries0

WetlandRiverGrassland4. Native GrasslandMixed habitatbeating on the bushes

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.7 °C 8.30–20.5

Seasonal swing summer↔winter26.4 °C

Max temp (day)19.7 °C 13.5–25.0

Min temp (night)10.9 °C 3.50–16.2

Precipitation81.3 mm/mo 47.9–113

Air humidity58.5 % 54.1–61.5

Moisture balance-27.5 mm/mo -75.1–31.9

Vapour deficit686 Pa 451–1,026

Wind speed3.20 m/s 2.10–4.80

Cloud cover43.0 % 36.8–53.6

CHELSA 1981–2010, ~9 km grid, at location & month of 96 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)