Philodendron vargealtense

Sakur. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Alismatales/Araceae/Philodendron

At a glance

Occurrence records49

Data sources4

Biological traits9

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Philodendron vargealtense's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility49 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF49 records

DNA & barcodingNCBIsequences

01Narrative

Philodendron vargealtense é uma espécie de planta do gênero Philodendron e da família Araceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction1

Life formclimber

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatewet tropical

Climberobligatory

Epiphyteobligatory

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Climber

Habitat GIFTFloresta Ombrófila (= Floresta Pluvial)

Woodinessnon-woody

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Philodendron vargealtense has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

The DNA barcodea real sequence read deposited for this species

ITSMG953780.1 ↗525 bp

ACGT

CTTGGTGTGAATTGCAGAATCCCGCGAACCATCGAATCTTCGAACGCAAGTTGCGCCCGAGGCCATCGGGCCGAGGGCACGCCTGCCTGG …

Philodendron vargealtense voucher 211FZ 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

08Occurrence & distribution

Record type49 records

Wild obs. + sensor20

Museum / vouchered29

Origin

Native9

Range

Area of Occupancy AOO124 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy12% within 1 km

≤100 m 1≤1 km 1>10 km 15

17 georeferenced · 3 without coordinates

Open the mapobservation + sensor20

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 29 records without

Open the institutions mapphysical evidence29

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Université de Bordeauxlocation not on record	6
UFESlocation not on record	4
Federal University of Espírito Santolocation not on record	4
Maringá, BR	3
Cascavel, BR	3
INMAlocation not on record	2
JBRJlocation not on record	2
UNICAMPlocation not on record	2
San Jose State University, Museum of Birds and Mammalslocation not on record	1
UNESP-RClocation not on record	1

10 institutions · 28 of 29 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)