Philodendron tortum

M.L.Soares & Mayo · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Alismatales/Araceae/Philodendron

At a glance

Occurrence records77

Data sources5

Biological traits9

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Philodendron tortum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility77 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF77 records

DNA & barcodingNCBIsequences

01Narrative

Philodendron tortum là một loài thực vật có hoa trong họ Ráy (Araceae). Loài này được M.L.Soares & Mayo mô tả khoa học đầu tiên năm 2001.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction1

Life formclimber

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatewet tropical

Climberobligatory

Epiphyteobligatory

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Epiphyte

Habitat GIFTFloresta de Terra Firme

Woodinessnon-woody

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Philodendron tortum has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

The DNA barcodea real sequence read deposited for this species

ITSMG953770.1 ↗507 bp

ACGT

GAATCTCGCGAACCATCGAATCTTCGAATGCAAGTTGCGCCAGGCCATCGGGCCGAGGCACGCCTGCCTGGGCGTCACGCCCCCCCGTCG …

Philodendron tortum voucher 032RD 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type77 records

Wild obs. + sensor11

Museum / vouchered66

Origin

Native5

Range

Area of Occupancy AOO160 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 2≤1 km 2>10 km 1

5 georeferenced · 6 without coordinates

Open the mapobservation + sensor11

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 66 records without

Open the institutions mapphysical evidence66

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record	15
Université de Bordeauxlocation not on record	12
Saint Louis, US	9
Bronx, US	8
Kew, GB	3
Chicago, US	2
Cuiabá, BR	2
Instituto Nacional de Pesquisas da Amazonialocation not on record	2
La Paz, BO	2
JBRJlocation not on record	2
Institut fur Allgemeine Mikrobiologielocation not on record	1
Museum of Zoologylocation not on record	1
UFAClocation not on record	1
Museu Paraense Emílio Goeldilocation not on record	1
Brasília, BR	1
University of Stellenboschlocation not on record	1
Chongqing Museumlocation not on record	1
Santa Cruz de la Sierra, BO	1
Cenargenlocation not on record	1

19 institutions · 66 of 66 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)