Philodendron squamiferum

Poepp. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Alismatales/Araceae/Philodendron

At a glance

Occurrence records243

Data sources12

Biological traits10

DNA specimens1

eDNA detections1

Sources12 archives

Databases and archives Philodendron squamiferum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility243 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF243 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB · GoaT4.5 Gbp

01Narrative

Philodendron squamiferum is a species of plant in the family Araceae, native to French Guiana, Suriname, and northern Brazil.Kew World Checklist of Selected Plant FamiliesMarc Gibernau and Denis Barabé, "Pollination ecology of Philodendron squamiferum (Araceae)", Can. J. Bot. 80: 316–320 (2002) This climbing plant has leaves with five lobes and has a climbing growth habit. It is well-known among Philodendrons for its distinctive reddish stalks, which are covered in small bristles that give it a hairy appearance.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height0.45 m

Life cycle & reproduction1

Life formclimber

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteobligatory

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Epiphyte

Habitat GIFTFloresta de Terra Firme

Woodinessnon-woody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Philodendron squamiferum has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences7

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMG953765.1 ↗496 bp

ACGT

ACGCAAGTTGCGCCCGAGGCCATCGGGCCGAGGGCACGCCTGCCTGGGCGTCACGCCCCCCCGTCGCTCCCCGCCCCCCGCCCGCAGTAT …

Philodendron squamiferum voucher 528CV 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK5★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Philodendron squamiferum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size4 547 700 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Philodendron squamiferum4.55 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 30 n = 15

Ploidydiploid inferred

Chromosome records30–342n range32median30mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 302×GoaT · Kew Plant DNA C-values Database · CCDB · kew

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · kew — Ghosh P, Mukherjee S, Sharma AK. 2001. Cytophotometric estimation of in situ DNA content in several species of Araceae. Cytobios 105: 177-183.

2n 322×CCDB · book-ipcn66 · CCDB · book-fedorov

CCDB · book-ipcn66 — Sharma & Mukhopad.1965

CCDB · book-fedorov — Sharma A. K., Mukhopadhyay 1964

2n 341×CCDB · book-fedorov

CCDB · book-fedorov — Jones G. E. 1957

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type243 records

Wild obs. + sensor153

Museum / vouchered89

Cultivated / captive1

Origin

Native2

Range

Area of Occupancy AOO548 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy44% within 1 km

≤100 m 29≤1 km 14≤10 km 24>10 km 30

97 georeferenced · 56 without coordinates

Open the mapobservation + sensor153

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤1 km 1≤10 km 1>10 km 1

3 georeferenced · 86 without coordinates

Open the institutions mapphysical evidence89

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	21
Bronx, US	16
University of Stellenboschlocation not on record	15
Paris, FR	6
Institut de Recherche pour le Developpement (IRD)location not on record	5
Kew, GB	3
Berlin, DE	2
Museum of Zoologylocation not on record	2
Museu Paraense Emílio Goeldilocation not on record	2
Université de Bordeauxlocation not on record	2
Chongqing Museumlocation not on record	2
Ulocation not on record	1
UnBlocation not on record	1
Philadelphia, US	1
Plocation not on record	1
Laboratorio de Ictiologialocation not on record	1
MeiseBGlocation not on record	1
Miami, US	1
Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record	1
Gump Stationlocation not on record	1
BISHlocation not on record	1

21 institutions · 86 of 89 vouchered records shown · 3 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Philodendron squamiferum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)