Philodendron oblongum

(Vell.) Kunth · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Alismatales/Araceae/Philodendron

At a glance

Occurrence records100

Data sources4

Biological traits9

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Philodendron oblongum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility100 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF100 records

DNA & barcodingNCBIsequences

01Narrative

Philodendron oblongum là một loài thực vật có hoa trong họ Ráy (Araceae). Loài này được (Vell.) Kunth miêu tả khoa học đầu tiên năm 1841.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction1

Life formhemiepiphyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatewet tropical

Climberobligatory

Epiphyte detailedhemiepiphyte

Growth formherb

Habitat GIFTFloresta Ombrófila (= Floresta Pluvial)

Woodinessnon-woody

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Philodendron oblongum has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

matKKU739305.1 ↗1 004 bp

ACGT

CTTGAGCGAACACATTTCTATGAAAAAATAGAACAACATCTTATAGTANTTTGTTGTAATGATTTTCAGAAAACCCTAGGGTTGTTCAAG …

UNVERIFIED: Philodendron oblongum tRNA-Lys (trnK) and maturase K (matK) genes, partial sequence; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3

plant barcode

08Occurrence & distribution

Record type100 records

Wild obs. + sensor35

Museum / vouchered65

Origin

Native39

Range

Area of Occupancy AOO280 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy44% within 1 km

≤100 m 11≤1 km 4≤10 km 1>10 km 18

34 georeferenced · 1 without coordinates

Open the mapobservation + sensor35

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 65 records without

Open the institutions mapphysical evidence65

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
INMAlocation not on record	13
JBRJlocation not on record	13
UNESP-RClocation not on record	10
UFESlocation not on record	5
UFRRJlocation not on record	3
UFPRlocation not on record	3
Universidade da Região de Joinville - Univillelocation not on record	2
Federal University of Espírito Santolocation not on record	2
Salvador, BR	2
UNIVILLElocation not on record	2
UFBAlocation not on record	1
Cuiabá, BR	1
UNISANTAlocation not on record	1
UNESClocation not on record	1
UDESC-CAVlocation not on record	1
CEPLAClocation not on record	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Criciúma, BR	1

18 institutions · 63 of 65 vouchered records shown · 2 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)