Philodendron martianum

Engl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Alismatales/Araceae/Philodendron

At a glance

Occurrence records115

Data sources9

Biological traits12

DNA specimens0

eDNA detections0

Sources9 archives

Databases and archives Philodendron martianum's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility115 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF115 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 34

01Narrative

Philodendron martianum, commonly known as pacová, is a species of plant in the family Araceae. It is native to southeastern Brazil.Kew World Checklist of Selected Plant FamiliesEngl., Bot. Jahrb. Syst. 26: 518 (1899).Forzza, R. C. 2010. Lista de espécies Flora do Brasil http://floradobrasil.jbrj.gov.br/2010 . Jardim Botânico do Rio de Janeiro, Rio de Janeiro

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formepiphyte

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max1 000 m

Elevation min0 m

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Climber

Habitat GIFTFloresta Ombrófila (= Floresta Pluvial), Restinga

Woodinessnon-woody

03Chemical composition2 compounds

Compounds documented for Philodendron martianum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Phenylethylamines2

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Dopamine		present	LOTUS
Tyramine		present	LOTUS

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Philodendron martianum has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMG953717.1 ↗474 bp

ACGT

GAACCATCGAATCTTCGAACGCAAGTTGCGCCCGAGGCCATCGGGCCGAGGGCACGCCTGCCTGGGCGTCACGCCCCCTCGTCGCTCCCC …

Philodendron martianum voucher 237JB 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Philodendron martianum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 34 n = 17

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 341×CCDB · book-fedorov

CCDB · book-fedorov — Jones G. E. 1957

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type115 records

Wild obs. + sensor76

Museum / vouchered39

Origin

Native12

Range

Area of Occupancy AOO308 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 47≤1 km 11≤10 km 2>10 km 4

64 georeferenced · 12 without coordinates

Open the mapobservation + sensor76

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced · 37 without coordinates

Open the institutions mapphysical evidence39

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Blumenau, BR	10
Université de Bordeauxlocation not on record	10
JBRJlocation not on record	4
Chongqing Museumlocation not on record	2
San Jose State University, Museum of Birds and Mammalslocation not on record	2
UNICAMPlocation not on record	2
Maringá, BR	1
UNISANTAlocation not on record	1
IAPlocation not on record	1
Kew, GB	1
Ivano-Frankivsk, UA	1
UTFPR-CPlocation not on record	1
UNESP-RClocation not on record	1
South Kensington, GB	1

14 institutions · 38 of 39 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)