Phidippus regius

C.L.Koch, 1846 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Salticidae/Phidippus

At a glance

Occurrence records1 984

Data sources9

Biological traits10

DNA specimens23

eDNA detections1

Sources9 archives

Databases and archives Phidippus regius's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 984 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

World Spider Trait DBMasaryk University10 traits · 2 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources10 traits

Occurrence & distributionGBIF1 984 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD23 specimens

01Narrative

Phidippus regius, known commonly as the regal jumper, is a species of jumping spider in eastern North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPeter & Barth 1991Wolff et al. 2013

Morphometry3

Body length16 mm

Claw tuft area0.236 mm

Claw tuft density3 215 mm

Predation2

Hunting guildambush hunters

Web buildingno

Ecology4

Circadian activitydiurnal

Microhabitatfoliage, shrubs, walls

Moisture 2semi-humid

Stratumshrub layer

Anatomy1

Brain size265 mm

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phidippus regius has left across the world's sequence archives.

At a glance

DNA specimens23

BINs3

Marker genes1

eDNA detections1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus20 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 14 variable positions, in barcode order

127Gvariable

184Gmostly conserved

229Gvariable

262Amostly conserved

265Gmostly conserved

271Tvariable

433Amostly conserved

478Tvariable

532Cmostly conserved

538Amostly conserved

556Gmostly conserved

565Amostly conserved

577Gmostly conserved

595Tmostly conserved

AACATTATATTTAATTTTTGGTGCTTGGGCTGCAATGGTTGGTACTGCAATAAGTGTATTAATTCGAATGGAATTAGGTCAAACTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.75%

Haplotypes6

BINs3

Most divergent pair1.8%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Phidippus californicussame genus5.6%Phidippus purpuratussame genus5.6%Phidippus princepssame genus5.8%Phidippus putnamisame genus5.8%Phidippus borealissame genus6.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 984 records

Wild obs. + sensor1 971

Museum / vouchered13

Range

Area of Occupancy AOO5 396 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 944≤1 km 306≤10 km 157>10 km 215

1 622 georeferenced · 349 without coordinates

Open the mapobservation + sensor1 971

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 8>10 km 1

9 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence13

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
US	4
Cambridge, US	3
	2
Museo Nacional de Historia Natural "Prof. Eugenio de Jesús Marcano"location not on record	1
Chicago, US	1

5 institutions · 11 of 13 vouchered records shown · 2 without an institution code

09Environmental DNA1 detections

Where the DNA of Phidippus regius was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.2 °C 26.2–26.2

Seasonal swing summer↔winter2.80 °C

Max temp (day)26.9 °C

Min temp (night)25.2 °C

Precipitation142 mm/mo

Air humidity63.5 %

Vapour deficit1,232 Pa

Cloud cover32.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Phidippus regius

At a glance

Sources9 archives

Morphometry3

Predation2

Ecology4

Anatomy1

At a glance

Record type1 984 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 5 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 984 records