Phereoeca uterella

(Walsingham, 1897) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tineidae/Phereoeca

At a glance

Occurrence records1 076

Data sources7

Biological traits0

DNA specimens9

eDNA detections15

Sources7 archives

Databases and archives Phereoeca uterella's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 076 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 076 records

Environmental DNA2 datasets · 7 countries15 detections

DNA & barcodingBOLD9 specimens

01Narrative

Phereoeca uterella is a species of moth belonging to the family Tineidae. It is commonly known as the plaster bagworm but as the term "bagworm" more properly refers to moths of a different family (Psychidae), it is often called the household casebearer – which may in turn refer to the related Phereoeca allutella. It is found in warm, humid climates throughout the Americas although the exact range is difficult to map as it is easily confused with other case-bearing tineids. It is common in houses.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phereoeca uterella has left across the world's sequence archives.

At a glance

DNA specimens9

BINs3

Marker genes1

eDNA detections15

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 37 variable positions, in barcode order

17Cvariable

19Avariable

89Tmostly conserved

97Tmostly conserved

106Tmostly conserved

115Tmostly conserved

127Cmostly conserved

133Cmostly conserved

142Tmostly conserved

172Tmostly conserved

211Gmostly conserved

247Cmostly conserved

256Amostly conserved

263Cmostly conserved

274Tvariable

278Tmostly conserved

286Tmostly conserved

287Tmostly conserved

335Gmostly conserved

361Tmostly conserved

364Tmostly conserved

382Cvariable

388Amostly conserved

421Avariable

427Tmostly conserved

428Cmostly conserved

448Tmostly conserved

529Cmostly conserved

542Tmostly conserved

544Avariable

578Cvariable

586Tmostly conserved

604Cmostly conserved

616Tmostly conserved

634Tmostly conserved

646Cvariable

652Cmostly conserved

AACATTATATTTTATTCTAGGAATTTGATCTGGAATAATTGGAACTTCTTTAAGTCTTTTAATTCGAGCAGAATTAGGAAACCCAGGATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.4%

Haplotypes3

BINs3

Most divergent pair2.3%

OceaniaOtherAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Phereoeca praecoxsame genus4.0%Phereoeca allutellasame genus6.8%Perithalera oblongatasame order10.3%Hemithea obscuratasame order10.5%Ornithospila succinctasame order11.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 076 records

Wild obs. + sensor1 065

Museum / vouchered11

Range

Area of Occupancy AOO3 428 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 519≤1 km 136≤10 km 53>10 km 106

814 georeferenced · 251 without coordinates

Open the mapobservation + sensor1 065

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 11 records without

Open the institutions mapphysical evidence11

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	7
The University of the West Indies, Trinidad and Tobagolocation not on record	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1

3 institutions · 10 of 11 vouchered records shown · 1 without an institution code

09Environmental DNA15 detections

Where the DNA of Phereoeca uterella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys2

Countries7

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map7 countries0

1. Forest & Woodland | 1.6. Subtropical/Trop…garden in suburban area

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.0 °C 20.8–25.8

Seasonal swing summer↔winter1.70 °C

Max temp (day)26.4 °C 24.7–29.8

Min temp (night)20.0 °C 17.6–24.5

Precipitation263 mm/mo 85.1–364

Air humidity67.2 % 59.0–74.7

Moisture balance117 mm/mo -46.5–228

Vapour deficit871 Pa 693–1,355

Wind speed2.00 m/s 1.30–4.30

Cloud cover33.7 % 20.0–52.9

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Phereoeca uterella

At a glance

Sources7 archives

At a glance

Record type1 076 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions1 of 3 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 076 records